Description :
From Genome Similarity Track
Location :
Scaffold_454:2- 1091
Sequence
1089 bases(100 bases per row)
TCCACACCTCTCGCAGCGAATGGCGAGGTGGCTGTCGTTCTTCGCAGAATATAACTTCTCCGTGGAATATAAGCCAGGACAACTGATTGTCATCGCTGAT
GCTCTGTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACATGTCCGACCACTGTCGTGGGGTTGACGTCGAGTGTCCCGTCGTCAACCTTAT
TCGAAGACATACGCAAGGCGTACGATCCGGCGATGGTGCGCTTGATGGATCATCTCTCGCAACCATCCCGTCTATCTCTTAAAAGGTTGCCCCCAGTATA
TCGATCCTCCACGGATAGATATACAGTTCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGCGACACGCCTCGTGTCGTCGTACCAGACCATGGTGAC
CTGCGACTGCACATCATGTATGAGTACCACGATGCACCTACTGATGGACATCGTGGTCGAGAAAAGACATATCTCACAATTAGTCGCGACTTTTACTGGC
CCCGCCAGTATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTCAACGAGTGAATTCAAGTCCTTCCCTTCGTGCGCCGTTGCAACCCTTGCC
CATTCCGGCAGAATGCTGGGAATCAGTCCCAATGGACTTTGTCTTTGGATTCCCCGCAGACCCACACAAGAATACAGGTATTCTTGTGTTCGTTGATAGA
TTCAGCAAAATGGTACACCTGGTCGCTGTACCTGAATCTATCAATGCATCGTCATGTGCTCGTGTTTTTATTGACACGATCTCTGGTCTTCATGGGTTGC
CTCGTAAACTCGTCTCTGATCGAGATCCACGGTTCACTGATGAATTCTGGCGATCCATGTTCAAAATACTCGGAACGCGCCTTCAGATGTCGACCTCTGA
CCACCCTGAAACAGATGGTCAGACAGAACGTGCAAACCGCGTTCTTGAAGAAATCCTTCGGGGTTATGTCCATTCGTTTACGAATTGGAGCGAATTCTTG
TCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCACGCCC