Description :
From Genome Similarity Track
Location :
Scaffold_4100:2- 1081
Transcript NameFunction/comments
Phypl_g16163hypothetical protein PHYSODRAFT_261931

Sequence
1079 bases(100 bases per row)
CGACGGTTGTTTAGCTTTCCTTGAATCTTCGCCTGACGATGCCATTTGTCTGGCGCGTAGTACTTCCAGTAGCCACGACGTTCACCGGGCTGCAGGTTGA
TCACATCCAGGGGCGGCTTTCTCGCGTACTCGTCTTCGTGCCGGATAGCCGAGACTTGGGCAACGTGATCTTGCACGGTACGTGGCGGATTCGATTCACA
TGTATTACCGTtcgaagtcgtcgatctcTCACTAACCACCTCTgtcggcttcttggccacatATGCATAGACGGAAACAGATCGCTTGTCTCGTACTGGA
TTCCAACCCAGCGAGCGATCTAGTTTAACATCTTTTCggccgacggcggcagcacccCCGCATGTTTCTGCGGGTTATACCACTGGCGTAGCTGGTTGAA
GAACTCTTCCAAAGGACACTCTCCCGCTTCATGAACGTCTCCGCAAGCTTTACAAGCTCGCAGGCATCGGTCGGTGGGGTGGTGACCACTACACTTCTGG
CACGTCAGGAGACTCCAACAATCGTCGTCGGAATGACGTCGCGAGCCGCAGTGGCGGCATCGGGGGCGATCCCGTCCCGGGTTTTCCTGACCCAGATCGC
GTCGGGCGATTTCCCCCGGCGGCGTCTGACCTGCTACGAACAATCGCGCCCGTTCCTCGTCATCCTGATCTTGGTCACAGATCGGATCGTCACTAGATCG
GCTCTCGCGTCCCGAGTCATACCCGTCTGGCGTGGCTTAGATCACTTGCACTGCGCGGGCCGGCTgcggcggagctggcacCTTCTGCCTGAACTTATTC
GACCCGAACAAAGTCTTCTTCTGATGCGACAGTCCACGTTGTctggcgcgcagcttcttctccagcgtggGGGTGTCAGGCACTTCCATCAAGGTGAGTC
GCGATGccagctcttgctcttggggACCCAGGGTGTTGATGAATAACTCCACGTGTTCCCTCTTCTCTTCAGTCGTGCCGTCCAAGTAGTGGATCTTCGC
CCGCATGCCGGCGACATTCAGTCGATACAGATAATCCAGGGGTGTTTCGTCAGGGTGCTTGGCCGCGTGATAGTAGCGG