Description :
From Genome Similarity Track
Location :
Scaffold_4175:2- 1060
Sequence
1058 bases(100 bases per row)
TCGCGTATTCAAGTTGAAGTTGAAAGAAATCATCGACGATATCGTCAAAAGGAAGATCTTCGGGAAGGTGGTTGCGTATGTGTACGTCATTGAGTTTCAA
AAGCGAGGACTTCCGCACTCTCACATGTTGATCAAGCTTGACGAGATTTCAAGACCCTAGACTCCTGAAGACTACGACAATTTTGTGACCGCGGAAATCC
CAGATCCAAACGTAAGTCCCCACCTATTCCAAGTGGTAACAAGCTGCATGATGCATGGTCCCTGTGGAACATTGAATCGAAGTGCTCCATGCATGCGCGA
CGGTGTGTGCTCGAAGGATTTCCCGAAGAGCTTCAATGAAGAGACTCGACATGACGGGAAAGGGTATCCAGTCTACAAGCGCCGGGATAATGGAAGAACC
ACGCTTCAGCGTGGAGTCGAGCTGGATAACCGTTGGGTAGTCCCGTACAACCCATATTTGTCAGCCAAGTTCAGTTGCCACGTCAACGTGGAGATCTGCT
CAACGATCGACTCTGTGAAGTATCTCTACAAGTATGTGTACAAGGGACACGATCGAGCCACGGTCGCTGTTGGAGAAGAAGCTGGCCAATCTGGGCCGAG
TGAAACAGTTGTTCAAGTCGCCATTAATGAGATTCAGCAGTTCCAAGACGGAAGATATGTGTCGGCCCCGGAAGCCTGCTGGAGGATTTTCAAGTTCAAG
CTGCAAGAGAAGTCACACACTGTGATCCAGCTACCTGTCCACACAGAAGGGAGTAATGTTGTCACCTTTCGACCATCAGACGACGCAGCCGGTGTTTTGA
ACAACTCGCGCCACACAATGCTCACTCGATTCTTCGAGGTATGCTCAGAGGATCCAGCAGCAGCCAATTTCCTGTACCATGAGTTTCCGCAGCACTTCAC
GTGGCAGCAAGGAAAGAAATGGAAGACTCGCCAGCAACGTGGAGAGAAAGCGATTGGGCAGATGGTTTGGTGTAGCCCAATGGACAGCGAGCGATACTTC
TTGCGTATGCTGCTGTGCTACCGCCGTGGGCCAAAATCCTATCAAGATCTTCGAACGA