Description :
From Genome Similarity Track
Location :
Scaffold_4064:2- 1044
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4064-snap-gene-0.1Respiratory burst oxidase

Sequence
1042 bases(100 bases per row)
CGGTAGTAGTCTTGCGAAGGTGCCCCCACCGGCCCATCGATAAAGACGGCGGGGAACGCACGAGCAATTGCACCAAAGCCACGCTCGAGGTCGTCGTCTC
TGCCTCCACCACTTCGCTGGAGACACTGCCGAAGCACAGCGTGGAGGGCACCGGTCCAGTCACCAGCATTGCGGATGTGGACGCTGACATAGTCGTCCTC
AGGAGCCGACGAGATGGTAAAGGGATGCCACTCGTACGTTGAGATGAGCGGCACCTTGAGGAAGAGATACATGCCCGGGTGGAAGTGGAAGCCATGGGGT
TTGTCCATGAAGACGGCGACCGTCTCCTTCGAAAACTGGACACGCTGGATCTGGGTATTGCCGCCAATTGCCGTGGTCGCCTTGACACGGTAGCGGCGCT
CGGCCGCGTAGAGAAGCAGTGGTGGCAGTACCCAGTAGTACGCCTGCGGCGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGCGAGTCCGTGG
ACAACGATGAGCACGAGGAACGGCAGGAGCATGAGGTGCGTGAGCCAAAAGGCGTTGAAATCGCCACGGCGGATCTTGGGGTGCGTGAGCGGTGCGGCCA
CGGCGGCGAGCAGCAGCATGAGCACGCCCGTCCACATGGGTGTGCGCTCGAGCAAGCGGGGGATGCTCTCGTTGCGCACGAAGGTCAAGTGCGCGTACCG
GGACCGCTGAAAGACGTCATCCGGGACCGTACGCATGTAGTAGGCGTTAAAGACCCACGCGACGGAGTGGCCCAGCGACGCCAGCAGCATGACGACGCCG
CAGATCTTGTGGAATTCAATGTTCTGGTCGACCGGGAGCCGAGACGAGATGGCTGCAAACTTGCGAAGGAACGCGACGAACTTGCGGTAGATGGGCAGCA
GTAGAAAGAGTGTGTTGACCATGACAATTTGGGCAAAGCCCTTGGCGATCTTGGCGCCGTAGCCGACTGCCGGGTCGTAGTGGACGTAGTACGCCTTGGC
AAAAAACGCGGCCACCATGAGAAGCACGTACAGAATGAGCCA