Description :
From Genome Similarity Track
Location :
Scaffold_4230:2- 1041
Sequence
1039 bases(100 bases per row)
GGGTCGATCGTATCGACGCGTAAAGTCCTCCTTTCTTTGACGATCAAATTTGATGACTTCAACTCGGTCGAACCGTTCATTGTCCTTGACATGGATGATC
GGTACGACCTGATTCTCGGCATGCCGTGGCTTATCAACCGATCGACTGGCGCAGTCACACCATCGGTGCTAGCCACAAAACTCTCGCGGACAGAGCCTTG
GTGGGTCATGTCCCCTCCTCTTCCCGAGACGGGTTTGTGCATGAGCACGGAATTTCGCGTGGCGAGCGGCACTTTGCTGGCACCTCCGAGGTGTTAGTGG
TGCCCCCGACACCGCCGGCTGGCCTATGCAGACCTCCTGCCGCTTCTTTGAGCGTGGGAGAAGGCGTTCGAGCTGAGGCAGCTCacgcaggagaaggcgc
aggaGCGGCTGCTCGCGTAACCAAAGGTGGTCGAGCTGGGGCTCCCACAACACTCGGAGCTCGGGCTGTAACAGCCAGTGATGGCGGACCAACCGACGTG
GGACGTCTTACGGCAGAGCCTACAGGCGAGGCGGCCTCACCGGTCGTCTTGGATGTTCTTACGGGTAAAACCCGGGAAGGTGTAGAGTTGGCTCCTCTAC
CAACGGTGGCGGacctgctcgagctcgaagagctgtcgtACGTTTCTCGACTCGCTGAAGGCGGGCGAGCTTGAGGAGTTGGTCCTCATTCGTCGTGAAC
ACGACTCAGCGGAACTCAACACCTCTTCGGTCATGGACCCCGACGTGTTAGAAGACGAGCAGTCTTCGCGGAGACACAGGCGCTATGGCGCTGCGATCCT
GAAGGACCCCTAGGATCCGTATCATTCCCTTTTGAAGGAATTCTCTGACGTGGTCAACGATAACCCACCGTCGGTGTTACCTTCAGATCGGGGCGTCCGA
CACGAGATTGACCTGGCACCCGGTACCAAGTACTGCACCACTCGTCAATGGCCGTTGCCGAAGGAGCAAGTCGATGTGATCGACGCGTTCTTCGCCGCCA
AGTATGCCGCTGGCATGGTGCGCGAATCTAAGTCACCAC