Description :
From Genome Similarity Track
Location :
Scaffold_3921:2- 1039
Transcript NameFunction/comments
Phyta_totarag15552hypothetical protein PHYSODRAFT_340195

Sequence
1037 bases(100 bases per row)
taaagataataattaacactttaggtgaaattgagaactgtatttggtttgcttatttgtcatgaatTTCCCTCCTAAAACTAATATTATGAAATAGAGG
TCTgtcgacgggtggtcggcagaatcctatgattctaattggtagaaagatgctgctttctactaatgagatctctaaatgtatgcggaccagtcgtccg
cctaaatatagccattggtgtgtcTCACcccaaggaaggaggtaattaaCGTCTAACATAAGCCACTACTGTTAGGttagccacttgtacgtgtaacccc
gttacaccatCCTCCCGTTAAGCTAAGACGTGCCAGCCCTGACACGCCAATACTTCGGAAATACTCGAACTCATTTCTCAATAATCTCGCCAGCCAGTAC
GCCAACGCCCACGACGCCTTGCGCCAGGACAGAGAGCGCCAGCTCAGTCGCGATACCATGCTCTGTAGAACCAGAAGCGTGGTGACGCCTCTGGGACAGA
CAAACCTAAGTCTGTCCGTGCTGAATCCTCAGCAAGCTCCGGGACGGAGACATCAATATTCCTGTGAACTATGAACCGAGttcagaggaagagggagaAG
CGATAAAAGACGAGAAGGTCCCGTCTTCTAAGCGAAAGAACGCCTCATCCACAGCTATCGCTGTGCGTGACCCTCACGCTAGGGTGCGCCGCCCGCGTGA
AGATGATTCGAGCGCTCTCAGCCCGAAGCGCCTGCTAAATGACAAATTGtcagcgcacgcagcagcgggAGTGCTTTCGTCACCGTGCACTGACACTACA
GTGCACAATCCATGGATGCCGTCTGCATCCAAGATGGTTGAGCGGTCTGGCTCCATGGTGCCGCCAAACCCGTGGCCGCTGTACGTGGTCAGTGGCATAG
AAGATGATGTCGCGGCCCAAGCTAAGCACTTTGATGTGTCGACGAATCAAAAGTGCGACTACTACGTCaggttcttgagctccgacatTTCTCGTGCAAG
AAAACTTCTCCCAAGTGTAATGTGTCCTAATACCAGG