Description :
From Genome Similarity Track
Location :
Scaffold_4169:2- 1035
Transcript NameFunction/comments
Phypl_g16198putative polyprotein

Sequence
1033 bases(100 bases per row)
CGCGTGATCAAGTCAAGGCtatcgacgagttcttcgagggCCGCCGCAAGGCCGGTCACGTGCGTGAGAGTATCTCACCACACTCGAGCCCGACCTTCTG
CGTGAAGAAAGCTACTGGTGGATGGCGCATTGTTCATGCGTTCAACAAGTTGAACGACGCGACCATTCCAGCGCAGACGCCAATCCCGCGCAaggacatg
gtgctggactCCATGGTAGGCAGTGTCATCTACAGCGCCATCGACCTGACCGATGGTTTCTATCAGATCTTGATGAGAGCCTGCGATACACCCCTCACGG
CGGTGAGCACTCCGAGCGGTATGCTCTGGGAGTGACTGGTGATGCCTCAGGGCCTGAAGAACGCGCCGACCATCTTCAATCGCATGGTATCCCATGTGCT
GCGCCCTCTTCGCGACTTTGCACCAAGCTATTTCGATGATATCTTCGTGCATAGTCGCGATGAGGGTGagctcagcgccgtcgaAGTCCACTTGAAGCAC
TTAAGGCAAGTCTTCCAAGTGATGAGAGAGAACAAGTTGTACGCGAACCTGAAGAAATGTGTCTTCTGCGCTCCGGAGATTCCGGTGTTGGGCTGCTACG
TGAGCAAGAACGGAGTTCGCGCTGATCCTGAAAAGATATCGTCTATCTGCTCGTGGCCGACTCCTACGAACCCCACTGAGTTGCGTCAGTGGCTGGGTCT
GGTAAACTACATGCACAAGTACACGAAAGACTACGCCGGACTCATCCAACCActgtcctcgctgctgaagaaggacaCCGCATGGGAGTGGCGTCCAGAG
CACAGAGAAGCTTtcgactcggtgaagaagagcttcgCGTCCGCGCCTATCTTAATGATCGCGGACGACTCGAAACCGTTCCATGTAGTCTGCTACTCCA
GCGACTTCGCCATCGGTTGCGCCTGTAtgcagttcgacgacgaaAGCCGAGCTACCAGTCCCGCCAGCTGAAGCCGACGGAGAGGAACTACCCGGTGCAC
GACAAGGAACTACTCGCCATGCGTTACGCTCTG