Description :
From Genome Similarity Track
Location :
Scaffold_4179:2- 1027
Transcript NameFunction/comments
Phypl_g16202pol protein

Sequence
1025 bases(100 bases per row)
GTCCATCTACAACACCTGCGCCAGGTGTTCCAGAAGATGCGCGACAACAAGCTGTACGCTAACCTCAAGAAGTGCGTGTTCTGTGCCCCGGAAATTCCGG
TTCTCGGCTGCTACGTTAGCAAGAGCGGTGTCCGCGCCGACCCGGAAAagatctcgtcgatctgTTCTTGGCCTACTCCCAAGAACCCGACGGAGCTGTG
TCAATGGCTCGGTCTCGCGAACCACCTCCACAAGTACACCAAGGACTACGCAGACCTGATCCAGCCGCTCTCGTCCTTGttgaagaaggacgcggcatAG
ATCTGGCGCCCTGAGCATCAGGATGCGTTCGAGGCCGTGAAGAAGAGTCTTGCGTTCGCGCCCATCTTGATGCTTCCAGATATGTCAAGATCCTTCCATG
TCGTTTGTGACGCGAGTGACTTCGCCATCGGATGCGCGTTCATGCAGTTCGACAGTGAGGGCCGCAAACGCGTCGTGAGTTATCAATCACGACAGATGAA
GCCGGCGGAAAAGAACTATCCCGTGCATGACAAGGAACTTCTCGCGATGCGTTACGCTCTGATCAAATTCAGAGTGTACCTCCTCGGCGAGCAAACGTTC
GCGGTGTACACGGATCACGCTTCGCTTTGTacggcgatgaagagcccCCATCTCTCTCAGCGCATGACACGATGGCTTTCTTTCTTCGCGGAGTACAACT
TCGTTGTGCACTACAAGCCCGGCAAGAACAACATTCTCGCTGACGCTCTCTCTTGGCGTCCAAACTATGACCCGCGGCGCTTGACGCGTCATCAGGACCT
TCctgatgacgaggacgacgacgaagactgTGCTGTCTGTGTGGCACTGggcatcaacgccatggTGTCGAGCACCATCCTTCCGCTGCGCCAGCGGATC
GCTGACGCGTACGAGGAGGACTCCTTCTACGCCGCGATTCTCCAACATCACCGCAATCCGTCGACGGAGACTCTGTCGAAGCTGACGCGTCCAACGCGTG
AGAACATCACGCGTTACGACCTGGA