Description :
From Genome Similarity Track
Location :
Scaffold_3901:2- 1025
Sequence
1023 bases(100 bases per row)
CTGATTTCACGCTTGAGATAATCAATCACATGAAAGGCCTTTAGAGAAGAGAAGCCTCAGGAAATTCAGCCTCGAGTGTCCTTAGAGGGGTAAAATCCTT
GGCAATAACTATGACTTGGATTTCCTTCCAGCATTCGTTGTTGATCTTGAACGCCGAAATTACGTTTTTCATGTTCTGTTCAGTTTCACCATCAATCAGT
GAATGCTGCGCAAACGCTCCACACCCGAATTTGTCCGTCACCATGAAGCTAAAAAGCCGATACCTAGAAAGGAATAGTTGAGAATGGTTAGAAAGATATG
ATAATATAAGCTAAATAAACATGATTGGTAAGTAGTTGGTATAGTAGTTGGTATAGTAATTGGTAGCGCAATTGGGTATCCAATTATTTCCCAACTATAC
CAACTATACCAACAGAGCCACCAACCAAACCAATTACGTCATTCTGCTCACCTGTTGATGTTCGTGCCATGAGTAGCATCAATGCAGATTACCTCAGGGA
ACAGACGCGCCATGCGTCTCATATGACTCGTCTGGAAGGCAATACAGCTCGTTAACTGAGAGTCCGTGTCTCGGTACACCCTCACCACGTTACCGGGGCC
CTCGCTGAAGTCATGTAGTAGCTCCGTAACGCGAACGTTGGCGTCAGGCGAGGTGTAGGACTCACGTCTCATCTCCGCGATCATGTTGTTTACATCTTGC
GTTTGAATCGGCTTTCCAGATACATCTTTCAGGTATCGGAGGATTTTTTTTCTCTTGGCTCCACCTTCCTAAAAACAAACTTAGTGATACGTAAATAATA
AAACATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTT
CGGATCCGACTTGAGGCGGCGGCGGTGTCTTTGCCGACGGCGTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGCCGCTACGACATCCGAG
GCACTCGTGGCCTCGTGTGATAC