Description :
From Genome Similarity Track
Location :
Scaffold_1951:2- 1021
Sequence
1019 bases(100 bases per row)
CAATCTCAAAAAGAGATATCGGTGGAGCTCTTGTACGGTATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTCTTCGTTTCCACTTGGTTGA
GGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCCTTGGCCATAGTGAGGGCGA
CCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGTCGACTG
CGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCCGCGATTTCGTCCCAA
TCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGCTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAG
TCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCTTATTAATGATGGGGCTCCGAA
CCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCACTGAAAT
AGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGCACGTTACCAGGTG
AGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCTGCGTACAAGCCGATCCAATAATAATC
GGACTTAACGCGGTGGAACGTTCTCACTACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTTTGCAGGACCTCTTGAATCATCGTTGTTGGTACC
ACAAGCCGCAGCTTGGTCT