Description :
From Genome Similarity Track
Location :
Scaffold_147:2- 1021
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_147-fgenesh-gene-0.3Protein kinase

Sequence
1019 bases(100 bases per row)
CGCTGCAGCGGGTCTGGGTGCATCATGCTCGCTATCAGGTGCTGCAGCGAGTTTGAGTATTGCCTGCAAGCATTTTCACATGCCCCACACACGATTTGCT
AAGATGCTTCTCCCACATAATAATCGCATTATCTACTACAGGAGACGTACCGAAACATGGCGAGATCACCGTCGCGGATTCGCTGCCAGTCTTCGCCTCC
ACTCGGGAGCGTTGACCCCAGTGCGAGTTCGTAAATCGTTGCGCCAAGTGCGAAAATATCACCTGCTCGCAAATCTGTGCGACTTCCTTCCAGCAGCTCC
CTATCGTGTAGAAATGTTGCGTGAGTGCTGCAAATACCTGATCTCAAACAGAACACAATAAGCAAAATCGTACCGACTCAAGTACCGGTTGTCGCCCTCG
GTGATCTCCATGCTGCCGTCCATGTGCGCCACGGTGCCCAAGTCCCCAAGCTTTACGGCATATACAATTCAGTACCTTAGATTCGCTCATGCATGAAAAA
TTCTCATCAGAACAGTTAGGCTTACCTTGTAGATGTCGCCCTCGGCCACAAGCACATTCTGGAGCTTGACATCCATGTGCACCATCTTCTTTGTGTGCAT
ATCGTGCAGTGCCTATTCGAAAAAGCACACCAGAGTTAGACACCTAACAGAGAACGAACACAATTGCTTAGTGTATGCGTACTTGAGCGATATGGCAGAG
CACTTTGCAAAGAGTGGCTTCGGGGATGTGATGTGGTTTGAATTTGTCGAGTATGCCGCCAAGACTGCAGCCTTGGCAATTCTCCAACTGGATATAGAGC
AAGTCGTCCTCGATCCACGCGTCAAAGTACCGCACGACGTGGCGGCTGTTGCTCAGCGCAGCAAGCGCCTGGACTTCACGAAGCGCGCGCTCCGTGTCTG
CTTTGCCGCGGAAATGGCGCTTGCTTTTCTTCACGGCGTACACCCACCCGTCCAGTTTCTTCATGCACTTGTACACTTTCGAAAACGAACCCGAGCCGAG
CAGCTCCAGTTCATTGAAA