Description :
From Genome Similarity Track
Location :
Scaffold_1369:2- 1016
Transcript NameFunction/comments
Phymu_g13177hypothetical protein PHYSODRAFT_353862

Sequence
1014 bases(100 bases per row)
CTCCACACAAGCTCTTCACAATGGCCCAGCCCCAGCTCAAGCTCACCTACTTCGACGTCAAGGGCATCGCCGAGCTCGTGCGCCTGATCCTCAACTACGG
TGGCATCCCCTTCACGGACAACCGCATCGCGCACGCCGACTTTGCGGCGCTCAAGCCGACGCTGCCGTTCGGCCAGCTGCCAGTCCTCGAGCTGGACGGC
ACGGTGTACGTCCAGAGCATGGCCATCTCCCGATATGCCGCCAAGCTCGCCGGTCTGTACCCGAGCGACGCAGTAGAGGCGCTCAAGACAGACAtgttct
cctgctcgttgGGAGATCTGGAGGACCCCTTCGTCGACTTAATGTTTAAGACGCAGGACGAGGCTGAGAAGacccagaagaagaaagtgttTATCGAGGA
GACGGTGCCCAAGTTCTTCACcgcgctggagaagatggtggcTGGCAAGTTCATCGTCGGCGAACAGCTCTCGTACGCTGATCTGCAgttcctcgacgtc
gtggagaacaAGGTGAAGTGGGCTTTCCCGGACTTCACGGTGGACGCGTTCCCCAAGCTAGCcgcgctgctgaacaacGTCAAGGCGGAGCCCAAGATTG
CTGCTTATCTGTCCAAGTAGTGGGACCCCTTTAGGCTGTCGTTCAATTTTTTCGTAGCACCCGTTTGCCTTAAGAGATTGGTCGATCGATTCATCCGTCC
ATACTTGAGCTTACACGCGATGGCCCAGTGGCCGGTCCAACTTGCTTAAAAAATGTAACGAGTATTAATACCTCAATCTGCTTCCCGGTGGTGGAGGCCT
ACAGTGTTGTCCCGCACTGGAGGCTACATCACCGGCATCGCCAAAGCATCATTTCGCTAGACATGTGCGCACGTATACTAGGACTATGGGGTTAGTGGAC
TGGATGAGTTTGCCGTCACTCACTCCTTGTCTTTCCTTGCCGTACAGGAATCCAGGAGGGTGATTGATGATCACTGCTTCCGCATACTGCAGCACAAATA
CCGATTGAAACACC