Description :
From Genome Similarity Track
Location :
Scaffold_992:2- 1015
Sequence
1013 bases(100 bases per row)
GCGGTGGATCCCGTCTTGGACGCCGATCCCGATTTCCGATACGGCCGTAGATCCCGTTTTGGCCGTCGATCCGGACTTGTTACACCGCTGATCCTGTTTT
GGATGGGGCAACGGATCCAGCCTTGGACGCCGTAGACCCAGTCTTGGGTCCGGATCCAGATTTTGACGCAGCAGCGGTGGATCCCGTCTTGGACGTCGAT
CCCGGTTTGGACACCGTCGATCCCGTTTTGGACGTAGCAACGGGTCCAGTCTTGGACGCCGAGGTAGACTTGGATCTAGCGGTGGATCCAGACTTGGATC
CGGCACCTGACTTCGAGGGAGAAACGGAAGTCTTGGGCGCGGGTGTAGATCCTGCCTTGGACAAAGAAGTGGATCCCGCTTGCGGAGCCGATTTAGAAAC
CGGAGTCGTTTTGGGCTTGGCTTTCGGGGAAGCTCGGGCCTGCTTATGGGGACGGGAGGATCCGGTGCTAGGAGCGGGAGATGTACTACGCGGGCGTTTC
GCAGTCGACGAATCCGCCCCACTTACCGTCGGAAGAGGAGCAGAAACGCTAGCAGCCTGAGAGGGCCCCGACAAGGGAGGAAGTGGATCCGAGACGGCAG
CTGTCACCAGCGCCAGTCGTCGACGTGCCAAATCGCGCTCCGACAGGCCGCGATCGCGCTCCAGGATCAGCTGTTGCTGCTGAGTTTGGGCTGCGGAAAG
TTGATCCTGGAGTTTCGCGGTGGTCGCATCTGCTTTCTTCAATTTGTCACCTAGATGGACAATAACAAGTGAATATGGAGTCACTAGCAAGGGCTAAAAG
AGGATCCACGTACTCATGCGGCGAAGCTTGGATTCCAGCTCCGTTAGCGCACGCTCGGCATCCGCCCACTCGGTAGTCGCCTTGTCCCGCTGGAGCTCGC
TGTCTGCCAGTTTCGTCCCGCAATCGAGTCATACGCACGAATTCTTCAAGCGCGTAATCTCGTCCGGTAGACGCCCTCTCGAGCGACTCCTTGGTGTCTT
GCAACTCCTCAGA