Description :
From Genome Similarity Track
Location :
Scaffold_4210:2- 1010
Sequence
1008 bases(100 bases per row)
ACAGGTTCATTGGCCCCTTCGAGGTCCTGAGTAGGCACGGCGCTGCCTACACGATTGGCATGCCTAAGTCGATGATGACCCACCCGACGTTTTATGTGGA
TCGTCTGAAGCGGTACCACGATCCGCAGAGGCCGACTGCCCCgcaggaagcggaagcggaCCGCGAGGAGGCGAGTGCACCTCCTCGAAACGAGATTGAG
TCTCTGGCGCCGGCGCCCAGctgaggacgacgaaggcgacgtcGGACACCCGTGGCAGTACTCCTGCTAATCGTACGCCGTAGGCGCGCTCCGTACGAGG
AGCTCTCGTGCGAGTACGGTGCACCCCACTGGCTGTCCATGTAAGGCTGTTGGTAAGCCCCACTGTTTGCGGAACCCTGGTccggacgacgaagccaaCA
GGCCTCGTCGGCAACAGGTCTTCAGCCCGAGCACGGCGATCGACCCGATCGTGCATCAAACGATGCTGGGAGTCGATGTGGCTCCACAGGCGGTTCAAGC
GGCCGTGctgtccagctgcagaagcggcTTGGCCACCAGGGCCAACGCCCGGTGCCATCTCCACAGTGTACAGACGCTCTTGGAGGGCACCAAGgtcccg
ctgcagcagagcgagtGCCAAGTCCGGGGGCCGATAAGGTCCCGAGTCAATCGCCGCAGAAGGTGACTGGAGGGAGTGATTGTGAGAGACCCCTCCAGTC
ATGCTTGACAGGGACGGAAATCTCCACTTCCACGTGGAGTGTGTGTCCACGAGAGGCGGTACCACTGGAAGTGCCACTTCTAGTAAAGTGGAGAGGTTAT
CCTTCTTCACGGAACTCTTGGGAGACGATCGAGCGGCTCCAGGCTGACTGCCCGAAGGCTGTCATGATCTGGGAAcagaagcggcagcagcttcgtaaGT
AGTCCGCGTTTTGTTTAGCCGTTCTACGGAATACGGTTCCTGACGAATGGAGACCGTATCCGCGATCGTCACGAGCGCCGgactgagcagcacgctTAAG
TCCCTCGA