Description :
From Genome Similarity Track
Location :
Scaffold_105:2- 1010
Transcript NameFunction/comments
Phypl_g3221catalase-peroxidase, putative

Sequence
1008 bases(100 bases per row)
CTCACTTTTCGTTTCACCTCGACGGCCGCAAGCCACCTCAAGCCGAAAGATGAACGCCCgcctcgtcgccttcgtcgccgcgctcgccggCCTGTCCAAC
GGCGCCAACGCCGGCAGCTGCCCGTTCGGCTACGACTCGGTCGCCGCCGTGCACCAGGTGGACCGCCAGATCTCCAGCGAGCTCTACGACGCGCAGAGCT
GCGATGTCGTCGACTACGCGCTCGTGAAggaggacctgctgcacctgatGACGGACTCGCAGGACTTCTGGCCCGCCGACTTCGGCCACTACGGCGGCCT
CTTCATCCGCCTGGCATGGCACTGCAACGGCTCGTACCGCCGCGCCGACGGCCGCGGTGGCTGCGACGGTGGCCGCATCCGCTTCAACCCGGAGCGCAGC
TGGGCCGACAACACCAACCTGGACAAGGcgctcgacctgctggagccCGTCAAGCTCAAGTACGGCGACGCGCTGTCGTGGGGTGACCTCATCGTGCTGT
CCGGCAACGTCGCCATCGAGAGCATGGGCGGCCCCGTGCTGGGCTTCTGCGGCGGTCgccgcgacgacgccgacggcacGAGCAGCCTGCAGCTGGGTCC
GACGCCCGAGCAGGAGAGCGTGGCGCCGTGCGAGGTGGACGGCCAGTGCAAGGAGCCGCTGGGCCCCACCACCTTGGGCCTCATCTACGTGAACCCCGAG
GGCCCCATGGGCAAACCCGACCCGGTTGGATCGGTAGTCGACGTGCGCGACACCTTCGAGCGCATGGGCATGAACGACCGcgagacggtggcgctgatcg
gcggcggccacgccTTCGGCAAGACGCACGGCGCCTGTCCGACAGGCCCCGGGCCCAATCCGACGGAGGACCCTTTGAGTCCCTGGCCGGGAACCTGCGG
CGAGGGCGCGCTCAAGGGCAAGGGCAACAACACCTTCACGAGCGGCTTCGAGGGCGCGTGGTCGTTCACGCCCACCAAGTGGGGCAACGGCTACTTCAAG
GGCCTTAC