Description :
From Genome Similarity Track
Location :
Scaffold_4586:2- 1009
Sequence
1007 bases(100 bases per row)
GTTTACCGAATACGTGATAGCCAAAGCAAGCGCGTCCAGAACTGCACAAACCATCGCCGAATCGTACGAGGAGTTGCGTTTTTCGAAGATTTGGAGCGAG
CGAGATGATTCGGCACGATCGGGAGCTAGGCTTTATGTCTGCTTTCTTTCGAGGCTTCAACCGGATCCTGGGGCAGAGACAGCGGGCGACTATGTCATAT
CGTCCCCAAGCCAATGGATCGGCCGAACGCATGATACAGACGATCACGAGGGGACTCAAGATGTATGTTCAGGATTTGGATCAGAGGAATTGGGATGAGT
ACGCAGAACGACTCACCTTTACGATGAACACCGCCCAAGACAGGATCCGGGGTGACACCCCGTTTTACTTGGTACATGGGTGGGATCCTAAATCCACCTT
GGAAGCAGCTATTCCGGTACGTAGCACCAAGAAAAGGAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAATATTACCGGCAAGCCAGATCCCAA
GTGAACGAGCGGTTACGAAGTGCGATACAGGATCGAGCGGATCTACACAACGCAGTTGCTCATCCCCATCAAATCCAAGTTGGATCGCAGGTGTGGCTGT
ATTTGGATCGGGTGAAAGAAGGTTACGCCAGCAAACTGGCCCATCTATGGCACGGACTGTTCCGAGTAAGTGAGAAGATAGGGGAACACGCTGTGAAGTT
GGAAACGACAGGTACCGAATATCGCTTGTTCCCTGTGGTACACGTATCCAAGCTGAAGCTGGTCAAGGCATATCCGGACCGGCCGCAAATCCGTCTTTCG
GTGGATGAATCCTACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGGGGGTGGATCTCGAAGCTGACTAGTTCGAAGTCGAGAAGATCG
CCGACATGAGGTCAGGGAAGCGAACTAGATATGGACGAATTTACCGCGAATTTCTGGTGTATTGACGGGGATATGACGAGCCTAGTTGGGTAGACGAGGC
AGATCGG