Description :
From Genome Similarity Track
Location :
Scaffold_3289:2- 1006
Transcript NameFunction/comments
Phypl_g15744hypothetical protein PHYSODRAFT_341850

Sequence
1004 bases(100 bases per row)
GCCTACCGACCGCAGGCGaacggcgctgcagaacgcaTGGTGCAGACGATCACAAGAGCGATTAAGATGTACATCGAGGACATTGACCAGCGCGACTGGG
ACGAGTATGCGGAGAGGCTTACCTTAGCGTTGAACACGGCCCACGATCGCACGAGGAACGAAACCCCTTTCTACCTTGTGCACGGATGGGACCCGAGGTC
GAcactggaggcggcgctgtctGTTGGCAACACGTCTCACCGCGAGGCTGaggccaggcgctggcgatTGCGGATTCAGAGGCACTACGAGATCgcacga
gcgcaagcgctgGAGCTAGTCCGTGAAGCAGTCGAAGCGAGAGCGCGAcagcaggacgaggtcgCGACAGAGCATACGATTGATGCCGGAGGGCAAGTCT
GGTTCCACCTGGATCGAGTAAAGCCGGGGTACGCGCGCAAGCTCACACACATGTGGCATGGGCCGTTCCgtgtcgtcgagctggtgaaCATATACGCCGC
ACGACTGGATACGAACGACACGCCCTACCAGCTCTACCCGATTGTGCACatctccaagttgaagcccgTCCGGGAGTTCCAGTCGCGCCCGGCGATGCCG
CTGACGGTGCCGGCCGACGAATGTTTCGATTTCGATGAAGAGCTCTTGCCCGAGGACAGCTGGGAAGCGGAGGAGTTGGATGACGACACCTTCGAGGTCG
AAGAGATCCTGGGCATGCGCGAGGGCCGAGCCACGCGATATGGCCGCACGCGGCGCGAGTTCGAAGTGAGGTGGAAGGGTTACCCCGACACGACGTGGGT
CGATGAACTGGATCGCAACTGTGGCGAAAATCCTGTACGAATTCTTGAGGCAGCGCATGGGGCGCAACCGGTTCGGCGTGATGCAGTCGCGCgagaacgc
ggcggcggagccCGACCAAGGTGGGTGAACGCCTTGGTGGGCGTGGTGGAAGTCGGCAGGAGGGCTGCCGACGGGAGGAatggtggagacgctcgttCTG
GGAC