Description :
From Genome Similarity Track
Location :
contig_103:19997- 22683
Transcript NameFunction/comments
g13513.t1hypothetical protein

Sequence
2686 bases(100 bases per row)
GCCTGCCTCGAACGAGCTCAAAACGCTGGTCACAAACAGCGTTTGTGCTCCGAGTCGGTGGTTGTCGGAGCTGGTGGGGGCCATATAGACGATGGGTTTC
GTTGGGGCAGGAGTCGGAGTGACGTAATAGTCATTTACACTTCTGGTCGCGGCGCTGACAGAGGTCTGCTGGGGCTTCGTCTGGGCCTTCGCCTGCGCGT
CGATGTAGTAGTTTGAGTTCATGTACTGCTCTGTAGTGGTAGTGAACACACTCCAGCACAACACCCCCCTTCTGCACAGCGAGCGCGTCTTCAATGAGCC
TTCGACCCTGGGCAGCTAAGTAGCGGAACACAGGTCGGCATGTTTCGCGTTAGTGATCCCCACTTTAGTCGAAAAAGAACGCGTAGTTAAGATGACAGCA
TTACCTGTGCGGCCTTGAGCACGGAATCCTTCCACGGCACTAGTGTGCTGAGAGCGAAGGCCAATGTGCCCTGCCACAGCAATTCCACCATCAACGATGG
TCGTGGCTGCAACAAGCAGTACAAATAGCTCCGTTAGTTGCCTCCAGTTCAGCTTCCGTGCAAGCAGACTGTTGTCCTTACTCGTTTCGGCGCGTTCCTT
GCCTCTCTCCGAGGGACCCTCGACCTGCACACAACCCGCGCCTCCTTCCTGTTGCCCCACGTCATTTCCATCAATACCACGTCGCCTTATCCAAGTCAAT
ATAAAAGCATACCTTCACTAAGTGCTGAGCGTTCTTCGGTGCTTCACACGGTGATCCTTCGCACCTTCCGAACGGCATGTTCGTGATCACCAGTGGACGG
CTGGCTCCACTATCAATAAATGCAACGATCAGCTACCCAGGAGCTCCCACGTTCGTCAGCAACACTTACCGCTTCACCGCCTGCGTGTGGTGGATGATGG
CCTCCAACGTCATTCCTTCAAATGCGCCAACAGTAGTGCAACCCCATGGCTCCCCACTTGTGCGTTGGGCCTACCGCGCCACCATGCCCAATGGGTCTCT
AGCCAGCAGGATGTCAAGCCCTGCTAGGTCCACATGCACCACCGACGGGTCGTCGTAGGCCGTGACCATGGTAATGGCTTTAAGCTTGCGCTTGAAGATG
TCGAGCGTCGGCAGCAGCTCGGTCACGTCCTTGGGCGTCTTCTCCTGCGTCCGTCACTGCAACCCACTGTCAATGCAGCACACAATCGTCAGTCTCCTTC
TCCCCAGCCAATCAAGTGGCGCTTCTCACCGACCGATTCGTGTCCTGCAGTCGGCAGTGGAGGCGACGCATGATGTTCTGAGCGCTCACGAAGCCTGGAG
CCTCCACGACCCCCTCGAGCGTCAGCGGCCCCCATAGCAGCAGCAGCAGTAGCAGCAGCAGCACCTTGGCGATGCCGCAGCGGACACGGTCTCTTGGCGT
TCTGGTACACGTAGCGCACGGGCTACTCCAGGAACTGCGTCCACTTGACGCTTCATCCAATTAGAACTGGATTTTCAACTTGAAGGCTAAGCTGGAAACT
CGGCCTGGAAGCTCGGCCTGGAAGCTTGGATATGTAGTTTGGAATGCTATATTTATAACTATAGCCACCTGTCGAGCATGTGATTGGTGGATGATCTAGA
TCGGACAACGAGGTGGCTGGAGCTCCACGACCGCTCCCCCGTGATCTACAGAGCCGTCCGACCGCATTACCATGAATCTGAACAGTGTTGTGCGAGTTGA
ACCCTGGTGGCGACTACGCAGTAACCTTGTGCTTCTTGTTGTAGACCTTCTCATAGCCGAACCAATCCTGATAGTTCGGGTGAGTCTTCATGTCTGATAC
GAAGTGGAGTCCCAACAGCTTCTTAACTTCCTCTGGCGTTTTACCCTTCAGCAGCCAATACTTGTATCGCACCTTCAGCGACAGCTTGTCGAGCATGTTC
AAGATTGAGGAGCCTTTGATCGCCTGCCGAGCCATGCTCTCAACATGCGACGGCACTTTCAACAAACTCTCAAGGTCACTTTGAACAATACCCACTCCCC
TCTCTTCATCATGCGTGGCATCGCCGTCTTCGTGATCCGTCTTGTCCGTTCGCAAAAACCTTCTCGCAACGGAGTCATTCTGGTCAATTGGCAGCATGCG
ACTCGATGTGGCCGAAGGCAGCAGAAGAGGTTGTTTGATATCTGCCGAGTCTGTATCAGCAGTTGCGTTACACGACAAACGCTGTCAACAGGAGGAGGTC
GTACAAACGCATGGATGTATTGACGAGGATTGTTCTTCTGGCCTTGGAGGTTGAGTCGCGAAATGAGAAGTTTTAGAGATGGGTAGCGCCAGTAAATGCA
GTGTGTGGATTCCTATATACTGCCCAGTAGGCAGTGCCTACACAGCCGAGGATCCCGCAAACCGTATTTCCCATTCTCCCTGAGAAGCGACACCCCCTGT
CGATCCTAAGATCGGCTCAACCTCGCGAACGTAGACATAAAAGTATCACGTCCTCTGTGTTATTATACTTGATAACGACGTGCATGCCGTCCAGCTGTGC
TTGACATCAATGTGCATGACTTTCAGCTGATGGAGGAAGGAATCCGCCATCGAGCAATAAAATAAAGGTTTTGCTACTCACGTATGCATCCCGTTCCCTG
TTTCAAGGCGACAAGGAGAGGGTCTACCACGACATGCAACGAGCATGAACGGCGTCAAACGCAGATAAGCCACAGCTGGAAATCCT