Description :
From Genome Similarity Track
Location :
Scaffold_65:199902- 209195
Transcript NameFunction/comments
Hyaar_Emoy2807539hypothetical protein
Hyaar_Emoy2807540cell division cycle 5-related protein, putative
Hyaar_Emoy2807541hypothetical protein
Hyaar_Emoy2807542mitogen-activated protein kinase kinase, putative
Hyaar_Emoy2807543hypothetical protein
Hyaar_Emoy2807544hypothetical protein

Sequence
9293 bases(100 bases per row)
AATGACGCGCGGGAAGGCGTCGGCTACGACCTGTCGAGGCGCTCACAAGCGGCGCCATGCAACAGTATCCGAATCATCCATCTCTTCCTCAGATGACGAC
CAAGAGCTGGTTGTCGACGCTCGTCGCCGCCGCGTCAAGCGCCACAAGCCCAGCGCTATTCTCTCGCAGTTCACGAGTCTCGACGCGTTACTTCACGATG
ACTTGACTGAGAAACGCAAGCGCGAGACCCGCGAGCGGAAGTTGCAGAAGCTGCGTGAAGAGAGCGAGAAGAGCTCGGGAGCTGGCGGGTCGTCGCCCAT
GGGCCAAGTCATGACGAACATGGCCATCAACATGTCGACGCTCTCTGGTGACAGTGACCTCTTTTCAACGTCTGAAGTAACTGTAACTGAGGAGAAGTTT
GGCTACGTGTTTACACCTATGACAGAGGTTGTGAGATGCTTGCAAGCATGCGAGCATGTGAACGAGCGAGACGGACTGAATGGAGGATGAACGAACTGAC
TGGTGGTGCCTTTTTTGTAAATGATGCAGGCGCTGCCGTACCGCACGTACAAGGCGACAGAGATGGATCTGCAGAGCGAGATGAAGCTCGTGTACAAGGT
GATGCAGTCGACGGAGGACGGAGAGCTGAGCGGACTGTTGTGGTCCAAAGCTATTCTGCTTTACTGCATGCTCAACTGTCAAAGCAAAGCGACTGCAACT
AGCGACTCTTGCAGGACACCAAGTGTCCTGCCTTTGAAGATTGCATCGTGGTTGTTTATGACGAGTAAGTTGCTGTCTTGCTGTCACTGTGTTGTGTGTT
TTTTTGTTGTTGTTGTAGTAATACCTAAGACGTGTGTGGTGTCTGCAGTGTCAGTTCATAGCGACAGTCACGTAGTTGGTGGATGTTTCAGCAACCTATT
TTTGATTCAGAGCTCGACTGCAAAAGCTTCGACTCAAAAGTTGAGCTGGGGGCTTCCTGTGGCGTGTTTTTCCCATTCGATTGAGGATTATTGCTCAGCG
TTTGGCACACAGGCCCCTCCTATCGAGATGGAGTGGAAACCGTCCATATATGACTTCCTCAATGCCTTTCGCACCTATGGCTTCCAGGATAGCAAGCGAT
CTATGAGTGTGAAGAGCAAGATCCCGGTGACACCACCGTCTGCAAAGAAAGCACGCGTGGTGCCGTTTCCGACTCTGAATATGCACTACGTGCTCATGTA
CTTTGTGCTCTGTCTGCGCACGAGAACGCTGGCGTTGGAAGGCTACGATGCGTTCAGCTTTACCATGTTTTTCTTGCGGATGCAGTTTGAGAACGCCATT
CATGCCAGCATCGTAGATTTGGCTACCATCTGTATTGAAGAGCTGCTTGACGTGTTTCCACGCACGGAGTGGCGGAAGGAATGGGCGCCCCAGCTTATTC
TTCGGATTGCTGGGGCAACGGAAGGTTTATTTGACTCGCCAGCGGGATGGCTTGCAGTCGCTCGTCGAATTCCACGTACGATGCGTGGTACGCAGCTTAC
CACGGGACTTGCGATCTATGTGTTGCAACATCGAATCGACAAGAAAGCACAAGAAGTACGTCATGCTAAGTTTTACTGTGTGTACGCTGTTGTCACACAC
TAATACCTGTATCGACGATGCGTTCTGGTGTACAGGTAACTTCTGAGAGGCCTCTAAAGTTCCCGATCCAGAGTGGTCTTGTCGTTGATATTGTGGCTGG
TATTGTCGAAGACTTGACACACAAGTACGCGGAGACGCGCGAGAATGGCAAGGTGTCAAAGAAAGCACCACCCTTCGATCTGCTGTGTAAGAAGGTGGCG
TTAATGGATTTGGCCCTGCAGGCATTTCTCAACATACTTACTCCAAAAGAGATGAAAGTTATGCTGAAAAAGCTAGACCAGCTGGCTGACGCACATAAGT
CCACCATGTCAGCAAAATGGCATGAGCTCAAGACGCTAGTAAGTCTCATGCATCGCAAATACTCGCTTGAGAATTTGCGCGTTGGTCGGAGTCTATCGCC
AACCGCAAAAACCGTGCTGTTTTGTGACGATAATGACGAGTAGTAATTCCTACAGAAATTTAATGTGATTGGAGGTTATGAAGGTTAGTAAAGCGGCATC
TAGGGGCATAAAGTCCGGCCACGGCCACAACTTCATACGTTACTGCCACTAATTCTGCTCTTGAAACAGTAACGCGTACTGCTTCTGTAGCTTGACTTCA
GACAACTGCTGCAAATTCAAGTCGTCTGCCAGTCGTGCCATGCGGCTCTGCAAAGCTTGGGTCTCGAGGTCCGCTAAGTTCTTAAAACACGCATGTTCTA
TCGTCGCATCTTGAAGCTCTGTCACATGGTCGTGCAGTTCCTCCAGACCACGTTGCAAGCGGCGGTGCAACCCGCCATTAACGACTCGCACTCGTTCATC
CAGCTTCTGTGCGCGCTTAGCAAGAAGCTGCTTCACTTCTTTAAGCTCAGCAAAGCAGGCTTGCACGGCACGTAATTTATCCTTGTCAGATGAAGCAAAC
TCAAACACCACGCCGTCACTTTTCCCGTCACTCCCAGCCTTGCTGAAATAACGTGCTTGCGCTTCACTCCACTTCGCGTTCATAACGGAAGCATCTTCGA
CTTTCCACATGCCCTCCACGCCACACAGGCTGGCCTCAATCTTCACCATTTGCCGCGCTCGCTCCATATCAGTATCGGAGAACTGCTGCAAACGCGGTAC
TGCAGTAACTCTCGAGGCGTGTTTGCGTTTCTTGTTTTTCTTCGACTTGCCATCATTCATCGGGTACGCAGTGAGGTCGTGCTCAAGCATACAGTACATT
TCGTCCGCAACCTCCCTCACTGCGCTATGGATCAGCACTTTCTTCACCTTCAAAGGACGCGGGAGATCCATTTGCACAGCGGTGGACCGCCGCTTGAGTT
CCCGCTCTTGTTCCAGCTCGCGTTGCTGTTGCTCACGAGCTTCTTGTTCTCCAGCATCCATCTCCCGAAGACCAGGGACGTGCTCGTCATCAACTTCGTC
TTTCTCGGGAACATTAATCTCATACTCATTTTGCGGCGCAGGCAAGCTGTCAAAATCTCGACGAAGGCTTGTGGTTATCTGCTTGGTCCGAGCCTTTTCT
GCCCTGGCATTTTTTTCGACCTCTGTACCATACAGCTGTTCCGGGTTGATGCCTAGCTCATCGCGCAGAGGCGTCCGAGCAGCAGACATCGGTGTGTTAT
CCCCCACTAAACTGGCTCGAGCTGACGAGGGTGTTCGTTGTGGGGTCGCACCGGCGTAACCCGTTCCCTCGTAGAGCTCAACGTTTTCGCCACCGAGAAG
AGGAGTTGTGCTGTTCCGCATGGCTAGTAGGTTCGCCGTTTCCTGCATGATATTATCGTGCACGTCGCGAATTGAGGGTGTGGTCGCTGCATTTCCTCTA
GTAGCAGAAAGTAGCGGTGTAGCTAGATATTCACCCATGAGAGCACGCGTCTCGAGTGCCGAATCATTCCCGAGAGCAAGCGCAGCTGCATGGGAGGCAT
GCATGCCTAGCTTGGCGAGGTCGCTCAATTCGTCGTTGGACACCATCGGAGCAGGTAATTCCAAAGCAGTGCGCCTGATGGCATTGATCGGGTCGTTCTT
TGCGTTAACTGCAGCAATAATCTGCGGCAAATTCGATTTTCCAAGCGATTTCTGCCGCTTTGCATCCTGTTTGCGTTCTTTCTTCTCTTGCGCATCGCGT
CGTACGCCTTCCAGCTTGTCCAGTTGCAATGCTGCCCGCTTGGGGTCGAGTCCTTTGCCGGTAACGCGTTTTTCCTCCGACACGTCATAAAAGCCCGCAG
GCGCTTTCTTTTCAAACGGGATCTCGGTCGCATAGTCAATATACTTGCGCTTCTTCATGTGCACACTCGGGTTTGACGACAACACGCCCGCCATCTTCAG
CTCTCGTTTCTTCTGCAAGACCGCCAGTCGTCGTGCTTCTTCGAGCTGCTTCTCCCGTGCCTTCCGTTTGGCTTTTTTGCCCTTTGTATTAGCCAGTCGA
GCCCGTGCTTCCGACAGCATCTCCTTCTCGTCTTCGTCCATGTCCACAGGGTCCGGCCGCGCCGGTTTGTTCTCTGGATTGGGGTCAATCTCACCCGGAC
GCAGCCGTCTCGGATCGTCACTCACGTCCACGCCGTCCTTCTGCTGCGCTGCGTCTAGCAGTCGCTCGTAGTGGTCCATACACTGCGCTGCTGTGCGCCC
CACGATAGGCGCGATCGTGCGCCACTGCGAGGGCATGAGCTTGGCGAGATGCAGCAGCTTCTCCTCTTCTTCGCGACTCCACTCGGTCTTCTTGATGCTC
GGGTCGAGCCACTCGTACCACCGCGCTTTGCACTGCTTGGCCGACTTGCGCGAGAGCAGAGACGCCACGCGCGCCCATTGGTTCATGCCGTACTTCATCA
CGGCCGCCTTGAGAATCTCGTCCTCGGTGTTTTTCCACACGCCGCCCTTGATCATGATCCGCATCGTCACCACAAGAGAGTCCTACAAACAAACAGAGAC
AGAGAGAGAAATAGATTGAGTGTGAGAGGAGGAGGACAGCGTCTATTTGGTCCAAGCGTGAAAATAGCGTGGACCACGTATTTATACGGTCACGGTAGTA
TATTGTGTTTAGTTGGTGTATAGTTAGTGTGGCGGACCGTTCGTATTGAAGTTTGTCATGGTGGAGCGCAGTCGGACGCTGCAGCTGCAGCTCGAGTTCA
TGGAGCGCACTGGACGCGCGGTCGAGGAGCTGGTGCAGAAGATGAAGAAAGCGCATGCAGAGCAGGAGACGTTTCTGGTAGCGTTTACCGCAAGTCTCGA
GGATCTCGCTGCACAAGAGACGTGTAAACCCTTGGCAAAGTGTCTCGAAGACCTGCGCGAGTGTGGCCAGTCGCTGGTGCGCGAGAGCCACGACGTGATG
ATGGTGAGGCCGGAGACGGAGATACTGGAGGTCGTGACGCAGGTGAATGACTTGGCGGTTACTCCCATGAAGGTATAGAGACGGGGGCAGGGAAAGGACG
GTCTCTTTTGAAAAGGGTTCAAGTAACAGGACGTTGATGTGGGTTGCTTTTTGCTGTGTAGAGGCTGTTGGAAGACCGGGAGAAGGCGGTGAAGATTGAG
GTGAAGCTGCAGACCGAGTTTGACGAGATGAAGGTACATGTGGGCGAGTTGAAAGTCATTTTAGTGATGTATTTTATTGACCGATTTGTTCATCTGCTTG
TTTTCTTTACTGCTTACTGCAGCGAGGAAGTGCTGCCAAGGAGAAGGAAAAGAAGCTCCGGATGCTGTCCGATCAGAAACGTCGCGTCGAGAACGTCAAT
GCATTGCTGGATATCCACATGGAGAGCTTTGAACGGTACAGAATCGAGAAAATGAAGGTGCAGTTAGACGGTAGTGGAGCGAGGTGGGGTGGGTTGACGA
GAATGTGGACTCATGGGCTTTTTATTTGCTGTAGAAAATTGTCGCTGAGTTGGCGCGCTCGCAGGCGTTTTACCATGCGAAAGGCCTGGAACTCTTTGCC
GTGCCATGCCAGGCTATTGCAAAACTTTACACTACGGATGTAGGACAATCAAAAGGGGCAGCACAAGTGAGTCCTAGCTGAAGCAGAGAACGCCTGTCAC
GAAATTGTTCATAATTGATTGATTATGTTAAGCTTTGTAAGCGTATTGTGTAACCTATAATGCTGCGGCAGAGCGTCGTCGTTCTCGCTCTTTTCTGCGC
TTGCTGTGCCCGAGTTTCGACATACTCTCCTGAAGCTTTCGCCAGAATGAACCCCTTTCGCGCGGTGTGCGTTGTGGACTGTCAGTACCAATGCCGAATT
GCTGGCGCCGTGAAATTCCTGGCGAGGCCGTCCAACTTTGCGGAGAGTAGCAGTAATTTTCTAACAGTTTGTCGCTGTAATAACAGCGTTTCTGCATTGC
ACAAATTTTGTCAGAGCCACACAAGCGAATCGACACGTTAACATCCCCACCTCTTCAAAATTCTCGTAAACCAAATGTACAGGCACATCCAAGTAGGTAG
CGAGGCCCAGTTGTAAGCTGTCGAAAAGCAAGCGCAAGAGGAGTTTGTAAGTCAGTAACTCCACTTCGACTCGTCTACTCTTCTGCTGTCGCCGGTACCT
CACTTGCACTGGCCGAAGAGACACTTGTCGTCGGCAAAACATAGGGGTCGCTTGGGACACGAATGATACTCCGGAGTCCGACTGAGAATGGTAACAAGAG
AGCCACACTCGTCAATTGAAAACACTGCTTTTTATCATGGCACACATGCAACTTGAACAGTGCTTACCTGCGGCGTGTGCGAGAACTTCACCGAGTGTTC
GTACATGTGACGATAGACTGCGTCACTCAGGGATTCCAATTCGCTACGACGTTCTTCGCAAAGGTGCACCCGGTCGATGAACGATGTCCACTATCGAGAA
TAAAACACATGATCAAGAAGCTGTCACACCTGCAATCGATAGAAAAAGATTTACCTCTTCGAGCGTTTCCTCAGCCGTGTATTTGTAAATGAAAGGATGC
TGAAGAAGTGCGTCTGCCGAAGGTCGATCGATCGGGTCATGTGTCACGCACTGCACACACAGGCAGTCAGCAACGTGTAACTTACAATACAATAGAGCCA
GGAAGACATTTACAGAACCTGATCGACGAAAGAACGGCATTCTTCAGAATACGAATCAGCCGGCAGTTTGAGGCATTGCTCATTTGCAACCTACGATAAA
CATCGTTGTCAAGCAGAAATATCAAGGAGCAACGCAACGAACATATCAGCTGCACTCACGAAGTCAACCAAACCAAAGAATCCATCCTGCGTGGGCAGCG
GATACCGACCCAATGCAACAGATATCATGGCAAGTCCAAAGGACCATACATCAGCTACAATAAAGAAGCGAGGGTCAGCGATTATGGTCGTTAGCAAGAA
TCGCGCACGTAGATTTGCTCACCTGGGTAGGAATAATCCCCGCCACCTATCCGTTCAGGAGCCATGTAAAGCAAGGTGCCCACGAACGTTTTTGTAGAGG
TAGTGTTATCATTCAGGGTGCGCGCTAAGCCGAAATCCGAAATCTTGACCTCGCCCTGCCGGTTCGTGAGCAAGTTATGCGGCTTGATGTCACGATGCAC
CATTCGCTTCTTGTGAATATGAGACAAGCCGCGCAGTACACCGGTCGCCAGTCGTGCTAAAACCCTTTCATTTCGACAGCCGCCACGCAAAATAATATCT
TGTAGCGATCCCGTACTCATATATTCCATGACCATACAAATAGAGTTTCTTGGACGATCGACAAATGCATCATAGAAGGATACAATGTACGGACTGGGTC
TACTTATCACGAGCACACACACAACAAGTTTATTGAGTCAACACATACTGCGCACACATATATGTGTAGTTGCGTACCTTGCTCTGGGTTTACCCGCGCT
TTTTCCGGTCGAGAAACGTTGCGGTATCGGACTGTCATTGTCTGCCATGGGTACAAGGTTGGAATATAGCGCATGAAGCTCACGCACCATTTGCCGCCGC
TGGCCACGTCCGTAAACGGGTACATCCTTTATTATGCAAGACACAGCTGCATGAGTGAGTGAAAAAGCATTAATGAGACAAATGAACGAGCACAAACCTT
GACTGCGACAACTTTGAGCGTTGGGATGTGAATTGCCTTATATACAACACCAGAAGCGCCCCGACCAACCTCTTTTACACGCTCAAGGTTTTCTTGTAGG
TGCAAGCATGCAGCATCGGGTGATGAGATACCTGCCTCTGATACTGCCACATTTTTGGTTGTAAACATGCCGTGATTAGGAGAATAAGCACTTCCTGCGC
TATGTCGCTCACCGTCTGGCCATTTCAAGACCACATACGTACTAGTTAGTACTGAATCGCCGAAGCTATATAAATAGTTCTGAACGCACCGTCTAGAGAT
TGAAGGCCCGATTCTGATCCTGAACTAAGATTCAATTTCATAACCGCTTGCTGTGCGGCACTGGGGCCATCTCCAAAATCACTTTGCCCCGACGAAGTTT
CAGCTGCAACAACTGCAGCCTCTATTGCATCTCGCTTTGCAATAAGTCGAGTTGCAGCTCGCTGGGCCCGTTCTTCCGCTTGTTGAGGCGTAGGCATGTC
TTCCAACTTCAGTCGTAGCTGAGGACGTTTACGAACGCGACTGGTGGACCTGCCATTTGCTGACTCGACAGCTTTCCACAGTGGTGCAGGACTACGCGTG
ATAGGTGGCACTGGAGGCGGCAAGCCTTCGGATGAGAACCACTCCCTTGTTGCCGGTGGTACGAGCTGTCGTGGTTCTTTTTCTTCTAGTAATGACGGAT
CGGTCGTTGCGTCAATCTCGTTGTTCATTTTTTTTGCTGCACTGTCTTCTTGATTCACCCAGTCATCCACATCAGTTCGACAACGTCCATTTTCCTCACT
TGTTGTCGATGCTGACTCTGGAACGCTAGACTCTGCATGAGTAAACGGAGACGCCGCAAGATCACTCGATTTTTCCGTATCTTGATCTGTTGTTTGGTTT
TGCAGCTGTTCCAACATCTCTGGGGCTGTCTCGATCTTCTTAGAAGTCAAACAGTCTTTACCCATCCACGGACACTTCCACAACTTCACTTCCGCAATGC
GCAGCTCTCGTGGACAGATATCTGGAAAGATGTGACTGATCATTTTGTCGTCCGCCTAACAGAAGAAAAGAAACAACAACGCCGCAACAGCAGTCAGCAA
TCCTGTCACCTCAACCTCATATACCCCTCTCTCTCTCTTTCTCTTGCTTTTCTATACCTGTTCCGTAAGATTTGGCGACGATTGCGGTCGACGTAGAGCC
TTCTCTTGCACCACGAACGCTGCACCATGCAGCATCCAGTCTGCTCTCCCCGCTCCAACAGGAGCGACCTTGTCCCTCATTGTATTAGCACAAAACGAGC
TGTTGAGCTGCATCTTCCGATTGTCCTCCTTCTCCTCACTTTCTTCTTGAGTGGTCCACGCGTTTGGCTCGCAATTGACGCTCTCTACGCGGCTGCGCTT
GAGGAATCTCTCCACGAGGTTCTTGCGGAAGCTCTCTTCGAGTGATTCGTCCATCAGATTACGGAGTTTTTTGGTCCGAAGAGACAGAAGAGGACCCCCT
GGAAGCTGATGAGTCAGATGGAGATCTCGCTCGTGCGGTAGTGGGCTTAAGCACGTGCTGGTTCTTCTGCTTTTGCTACTACGTCAGCGGCACTGGCACT
AAATGTCGCTGCTGTACGAAAAGATGTGTATCCCTCTCTTCTTGAAATCCGAAACGAGTTTGAGAGGGATATGAAGAAAGACAGGGACAAGCG