Description :
From Genome Similarity Track
Location :
Scaffold_265:19981- 21888
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_265-snap-gene-0.19Cystathionine beta-synthase

Sequence
1907 bases(100 bases per row)
CCGACCCGTTTTGACACGAGTTATTCTCGCAGAAAGTGATAGGAAGACCTGCTCATTTCCGCATTTCCGCATTTCAATTTCAACAAGCGATCCATATCTC
CTAAAGAGAAATCAGAGAAGGACGTGATGGCTGCCGCTACCAACTACGAAGACGTGCTCCCCCCTGCAGCGCTGCAGGTGCTGCCCAACATCCTCGTACG
TACCCTACTATTACGAGTGCCGGCGTTGCTATTGTTATCTACGCAATGAGGGTGTTTGGCTTTGTGATGCTTGTTTCTGGCGCTGCCGAGATCACATACA
TGCTACAGACCAAAGTCGGGCCGATAGTCGTGACCCATGCGGATACCCACTGGATGCATGGCGTGTGCAATTTTTTGATAGCGTATCGGCTGTAACATGT
ATGCAGGCTGCGATCGGAGAGACACCGATGGTGCGCATCAACAGCATCTCGAAGAAAGCGCATCTCGAGTGTGAGCTCCTGGCGAAATGCGAGTTCTTCA
ACGCCGGCGGATCGGTACGCTGCTGTCTATTGCATTTGCCTCATGATATCAGAGGGTGAAGTCGTAACAAATATGCCTGCGCAGGTCAAAGATCGAATCG
GTAAGCGCATGGTGGAAGATGCAGAGAAGGCGGGACGCATTAAGCCTGGCGACACGCTCATCGAGCCAACGTCCGGAAACACCGGTAACGATTCATGGCT
GGCGTGCATGTATTTATCTTGCATGAAGCCCTTAATATTGACAAAATCTTTTGCTGAACGCACCACATTTGATTAGGTATCGGCTTGGCACTCGCTGCGG
CGATCAAGGGCTACCGCTGCATCATCACGCTCCCCGAGAAGATGAGTCTTGAGAAGGTGAACATCCTCAAGGCGCTCGGCGCGGAGATCATCCGCACCCC
GACGGAGGCGGCGTGGGACTCCCCAGAGAGCCACATTGGGATCGCCAAGCGATTGCAGAAGGAGCTCCCGAACGCACACATCCTGGACCAGTACGCCAAC
CCATCGAACCCGTTGGCGCACTACGAAGGCACGGCGGAAGAGATCCTGTACCAGTGCGACGGCAAAGTCGACATGGTCGTCATGGGGTGAGTTGCACAAG
TTTCGAATGCTATCCACCGCGCATACGGATATCTGACTGCATGCTCTTATTGTGTGGAAATCATTGGCAGTGTCGGCACGGGAGGTACGATTTCTGGTAT
CGCGAAGAAGCTGAAGGAGAAGTGCCCGGGTGTGATCGTGGTCGGCGTCGACCCTGAAGGTTCGATCCTCGCGCTCCCCGATTCGCTGAACGACAAGAAC
CGTCTGCAATCGTACAAGGTCGAGGGTATCGGGTACGATTTCATCCCGGATGTACTCGATCGCTCATTGATTGACGTGTGGGAGAAGACGAATGACCAGG
AGTCGTTCATTATGGCGCGACGCCTGATCCGCGAAGAAGGGCTGCTCTGTGGTGGCTCGTGCGGTTCGGCGATGGCTGCCGCTGTGCGTGCGGCATCCAC
ATTGAAGAAAGGACAACGCTGCGTTGTGATCCTGCCAGACTCGACGCGCAACTACATGACCAAGTTCCTGAACGACTCGTGGATGTACGCGAATAAGTTT
GTCGACAGTACGCTGCACACGAGCGAGAACTATTCGACGTTCCGCAAAGATGCGTCCACGTGGTGGGCATCCAAGAAAGTGTCGGAAGTGCACGTCACCG
CGCCATCGACTGTGGCGCCGCAGATCACGTGCAACGAAGCGATCGAGTTGATGGAGAAGCGCGGCTTTGACCAGCTCCCCGTTGTGCACGACGGCGTTCC
ACGTGGCGTGGTGACGATCGGCAACCTGCTCTCGAAGCTGTCGTCGGGGCGAATCTTGCACAGCGACCCGGTGAGCAGCGTCATGTTTGGCAACTTTAGT
CGCGTCA