Description :
From Genome Similarity Track
Location :
Scaffold_3660:1998- 3032
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3660-snap-gene-0.1Myosin

Sequence
1034 bases(100 bases per row)
GCGCCACGCGACTCGCGAATGCACGATCTAAGACCTCGACCAAGGGCTCGGCTCGGCGTGTCAAGGACCATTGGGAAGAGATCCGCAACTACCCACCGCC
GATGCACTACTCGCTGGGTTCGGTTCCGTGGAAGCGTCTGCTCACGGACTGGGCGCAGGGCAACCCGAAGAAACTCGATTACATGACACGATGGCTCAAG
AACGTACTCGACGGTGGGCCGATCGTGTCAGATACGTTCCCGATGGGCGTCGAGCTCAAGTACGTCACGCCTATGATGCTCGATGGATTCATGCAGCTCG
TCATTCCCAAGCTTGCGGAGCGCCCCGACGTGCAGGTCCATGTGCACACCAAGGAGTTTATCGGCACGAGTATGCGCATCACGTTGTCGCCGTTGGAGGG
CGCCAAGGCCGGGCGAGGCGGTGGTTCGTCGGTGCACTTGCGTGCCGGAGAGCACGATGACTACAGGGTGTCGATTCTCGCAAACCAGAGTCCTTTGACA
AGCCGCTACTCGTCGTCTGGATCGACCGCTAGTATGGACTCGTCCTCGTCGTCGGCACCGAGCGTCAGCTCGGTGCACCGTCCGAGCGGAGGCTTTTTCC
GCTCGAGCCGCAGCAGCAACCACGGTGAGTCGGGGCGAAGCTCGTTCTTCCAGCGGAAGTGAGCTGCTTCCATCATGTTTGGATCTCGAGAACGATCCAT
CAGTCTTCGCTACTGAGGAGCGTGTAGAAAATGTGCCACGACGCTCCGGTCGTGTTTGGATCTTGAAGAAAGACGCTACGGAAGACGGCAATACACCATC
GCGACCGTGGCGGACAGAGAAGAGTAGGTCAGGAAAGAAATATACCTCCATGTGAATCAGGAGAGAGGAGACGGAACGCCGCGATGCTGCCTTCTCCACA
ATTGCAGCCACTCAATTGCAGCCACTCCAAATTGCCACCAGGGCCTGGAAGCTCGCGTGGGATCCATGGCCTGACTCAGGCCAGGCAAGCTTTTGCTGAG
ACTGCTGTGATGATACTATGCAGTCGTACTCTCC