Description :
From Genome Similarity Track
Location :
Scaffold_308:19979- 21141
Transcript NameFunction/comments
Hyaar_Emoy2813668RabGAP/TBC domain-containing protein

Sequence
1162 bases(100 bases per row)
AGCAATAGTCGCCACCGTATCGAAAAGAGCTTGCTCCGACACCAGCATACTCCACTCTTCCTGGTAAATCACATTGCGCTGCAACAAAGGGAGCGCAACA
TCAATGTCCGCAACTATCAGCCGTGGACCCAATAATTCGTGAATCGCCATGGCAGTACGGAAGAGAAACACCGTCCCGTCCAGCAAAAAGTTGTCAAACA
CACGAGTTGCTGACTCGAGTGGCAGCACCTGCAAAAAGAGTGTCTGGAGCCAGTTCATGAGATACATGGAGCAAGACATGATACCAATCTCCCGTAAATG
AGCGTGAAGATGAGGGTGCCGCGAGTTCAGAAACGCGTCGAACAGAGTGTAGTACACATTTGCGAGATCGGCGTCCAGCAAGTAGAAGGTAAAGAGATGC
TCGTTCACCATAAGATTCGCCAAACACTGGAAGGCCAGATAGCGGTCTTGGGGCATGTGCAGACAAAGCATAGCGGCCAAGTACGACATGCCTTGGATGT
ATCCCAAGTCAGGTCGGTAACACGCATATGTTTCAAGGACCTCCAGCAAAAAGGCGTAGTATGGACCACTCGAGTCGAATAACTTCAGTGACGGGAACGT
ACGCGGTAGATCCGTGTCAATTAGTGCCAAAGTATGTTCGCGACCGCCATCCACAGTACCATTCTCTTCCTTTGCAACTCGATCCTTCTTGTAAGCAATT
GCTCGTCGACGGTAAATCTTAAACATCTCAGGCGTCACCTTCAGCTTATTGCCAATAGCCATGGGCCACACGCGAGCTCGAATCGAGGGCGGGATACCCT
GACGCCACAACGAATGTGCTAGCGGCGTGTCCTTATTTTCCTCCCAATCGCGCAAGATGCGGGTGCGCCAAAGCTTCTTAGCTCGCCGCAGCTCCTCCTC
CTTTACATGGATAGCCTCACGCGGGACATCGTCGAGCTCCATTGCCGTATTGAAAGAGGAACCTCGTCGATGCCGTGTTGCACTATTCAAGGAGTTCGGT
ATGTCCGACAAAACTCGACCACGATGTAAAATATCTTCACCTGCTTCACTGCCCTCCGAAATCTGCCTTTGTGTCCTTGGCACGTTCAGTCTATATGCTG
ATGTTGCTACTGCTGCTCCTGCCTGCGCACTTGCTCGAAATGAGGAAGAATCGTGTCCGTTC