Description :
From Genome Similarity Track
Location :
scaffold_6:199773- 208922
Transcript NameFunction/comments
g1918.t1hypothetical protein

Sequence
9149 bases(100 bases per row)
AACAATGCGGTACCGCGGCGCGTCCAGAGATCAGGAGTCTTGCCGGGTCCTACTTTGAGATCAACGGCAATCATGAACGACGGACGCTCACGCGTGCCCG
TGCGCAACGGGTACATGTAGAGCGGACAGCTATACAACCCCTTGGCAGACTTCTTCTTGGCTTCAACAGGACGGAAATGAAGGATAGGCATACCGCAATG
CAGCTCCATCGGGTGCGGTTCCGCTAGACAATCGTGGTCAAAGTCCCATCGAGCACCCTCCAGAATGAGTCCTTTGATGTAGGCGCCGTCCTTCGGGCCC
GTTGGCAACGCGTTCTCGCCCTGGTTGAGCACAATAAACTCCCAGTTGAGCGAATCGATTGCCAGTCCATTTTTGCGAGCTGCTGTCTGAAGTAGCGCTG
TCAGGAACCCCGTTGGATATGTGAAGCCTGTGAGCCAGAATACAGCAGGTTGCGCTTGGTTGGCCCAACGATCCATTTGCTCGCAGCGGAGCTTCAGGTC
CTGTGTCCACGGTCCCAACGGTTTAAGGGAAGGGTAACAGAAACTCCAGGCCGTGGGTACAGCGCCTATCAGCAAGGCATTGTAAACAGCTTCGAGCTCT
GGCGTGATAACGACGGAGCCCTGGATGCCTTTCTCCAAGGCTCGTGCTGACGAATTGATAGTGGCGAGTAGTTTGTTGTAGCGCTCGAGCTCCTGCATGA
GTACTGTCTTGAGCGCATCTGGATCACTTCGTCCGCTAAGCCCAGCTTTGATGTTTGCGAGGTCAAACACATCGGGCACTGTTTCTCGCAGGGTTTGTAG
TAGTCCCAAAACCGTGTCGTCGTTCCCACTGCCACCTTCAGCCACGTCAAGTGCCTGGAGAGACAAGATCGTGGCCAGAAGCTCTCGGCCATCATCGATC
TGCGACGCGATCTGTGCATTCGGATGCTGGCCAAACGCTGCAGGTGGATCATCCAGCGGCAATTGGCGAGTGTACTCCGTGTACGAGCCCAACTCACCGT
CGTCTGGAACGAAGTAATATTCTGAGTCCGACAACAGCATGTTATCCACAGTCAGCACATTCTCAGAGAAGAACTGCGAAATATACACTAGCATGAGGCG
ACGATCCCAGTCATCTGTCACACGGCCACCATAGTTGGCCTGAGCGATAAGGTATTTGAGCGCGTCCCAAGGGGTATCCTCGTATTCGTCGAGATAGATG
GCAAGCACGTCTTCGCTAATGGCGAAGTCCGACTCATTGAAGTCGTACGGGATGTTCCAGCCAAGGTTGTTGAATTTGCGTCGTTCCAGCAGTAGCGAGT
GGAACCAACACAAGCAGAAAAGCAGTCGCTTGTACTTCTTTATCTGTCGACACCGTGCAAACTTTTCGGGAGTGAGCGTGTTGTACAGTCGAGTTAGATT
GGCCTTCAATCCACGAGGTGGTTCAGTAGTCATCTTGATTCCGCGCTGCAAAATTGCGATGGGGAACTTCGGGTTTGGACTGCTCGTCAGCCACAATCGG
AACTGTGGGTTAACAGAGCCAGCAGGAGCTGGAGCGGCGGCACAGAAGTTGTCAATGAGCTTCTCTAGCGTTGGTGCCCAGCTAAGCATCAAGTGGCAAT
TAGCAAGGAAAACCCAGTTTCCAGCATCCAGTCCACGTGCCAGCATTGCCTCGGCGACGCTTGCTTGGCCTTGCCCAAGTGCACAGTTTTCCACTGTTTT
GTGCAGTGAGTCAGCCAGCGCAATTAACGAATTTGTCGGGTCCACGCCAGGAGACAGCACGAAGATGAGAGGTGTCTTGTAGCTAGATGTTTCATAGATA
GCCTTCAGGTCAAATGGTGGTGGGTCAACAAACTGTGCCCCCAGATGTGTGGCCGTAAACCGAGCTGCCTGAATGCTGAGTCGATCAGGTCGGACACAAC
GGAGCAGCAACATTCTCTGCAGCTCGTTGCACTTGCCCTCCCAATCCCCGGGAAGTGCCTCAATTTCGGGAGTACTGCTCTGGTACCACGATTTCCAAGC
CTTCAAGGTTTGCTCAAAAGAGCTGATAATACCGTGAAAAGCTGGCAACTTGTTGAGCTCGACAATGCTAGCCCAGGCGCCTTCAGAAAGAAACTCGTTG
GCAACATTTGACACCTTCTCTTCTTGCGCCAGGACATTACCACCCTTAAGCAAGAAGTCGTACTCGTCGTGAGGGAGCTTATTCACACTTTGCAGAACAC
GGGCGCACATCTGCAACGAGAACAGCAGCTTGTGGCGCTCGAAGAGTCCCCGGCACGCATAGGCGTACACGGCGTACGTATGGTAATCATTGATGGCGTT
AATACGCTCCGTGAGCTCCTCGCTGAGCGCACCCTGGTTCTTGAGACTACGACTTTTTACGATCGAGTCCTGGAAAAGCGCCACGTACGCGTCAAGTGAA
AACTGGTACATTGGATCAACACTAGTCATGTCGTTCAGCACAAAATACAGTGTTGACGATCGTAATGCCACGCGCGCATATCCCATGCGGGCAGCGTCAA
TCTTTTTCTCAGTTTCCTCGCTGATCACGAGCTGCACCGAGACCTCTTCGGAAGTAGTCTTGGACGCGTTCAGGGTCGTAACAAGCTGCTCGTCATCCAA
CAGCGAGCCCTTTGCTGCAGAAAGCAAACGCAAAATTTCGTTTTCGAGATCAATCAGTTTTTTCTTCGCCGCAGCCACACGCATGACGAGGTCGGACTTC
TGCTCCTCTAACGCTGGTTCCTCAAGTTGAACGGCGATACCAAGCAACTGGGCCTCAAGCCCCTGTTCCTTCACAACAAAGTTCACAATTGTCGTCTTGG
TGGACACCTCCGGGGTGTAGTGGGGGTTGTGCAGTTTCGTGGTGAGGTAGAAGCGGAACTCTCGGTTGTAATCTAACTCTTTATCACCGAGACGAAGAAC
TTCACGGTTTCCCACCTTGATGATACTCTTAGTGAGAACAGGTTCAAGGCTCGGATCCAACTCCTCCAAGATATCCTGCATCAGCACTGGTGAACCAAAG
CGAATGCCGTTCTCCAACTTGCGCAGAAGGTCCTTCATCATTGGGTCAACGACTTCAAGTCGTGACCCTTCCATTGCCTTAATCCATTTATTTGCCTGAC
CTTGAGGGTCAATCATGAGAGGCCACCTCTTGCCCCGTGTTGTGATCACACCATTCTCAGTGGAAAGTGGGTCACGCGGGAGGCCGTGTGCATTCCAGCT
GCGTACATCTGTTGGATCCGCTAGGAAATCGATGAACGTAAATTTCGGTGACAATGGTAGAGCTTGTTGAGTCACCCGATTCATCCACGTATCCACGAGC
GATCCACGATAGAAAGTGTCAAACGGGCCTGCGTACGAGATGAAAGCTGCAGCAACAAGTGCATCACCGACGACGTTTTGGAGGCTTGCGTTTTTATCGG
CAATAGATCCTTCCCAGCGCTCACGCTCGCCGGCCAGGCCCTTCACCAGTTGTTCAGCTCGAGAGAGTTTCAGTTCCAGCAATTCAGCCTCTTCGCGCAG
TGCATTCTTCTCCGAGACGCTCGTATCGTATTGATTTTTCAGAGCCTCGACTTTTTCTGTGACTTCTTGAAGCTTCTCCTTGGCAACCTGGAGATCCTTT
TGCTTGACAGCCAGTGCTTGCTGCGACTTTCGAAGTACTTCTTTCTTCGGTAAAACGACACGGAAGACCCCAGAGTAGCACTCCATTGCTAACACCCATG
AGCACAATGCTCCAGCTGCAGACGATACCTTCCTGACTACATCTGAGTTAAATGTTGGCTTTGAGGTGTACTTCTTGAGCGCAGTGACAGTCTTGTCGCG
AATCGAATCCTTATCAAATGTCTTGATTTGCTGCAGAAAACTCACATCATTCATTTTCGTCTTGGCTGATGCCCACGTTGGGGGCAGGCCAAAGAGAATC
ATCACAGCACACATGACCATCGAGACGGCTTCAGGTGGCTGGGTATATACTTTGACCTCTGCAATGGCCTTTTTGTCCAGATTTTCCACCTCCTGCATTG
CGCGTTGTAACGCAGGCAAAGCCTCATCCAAATCCTTCTGTGCATCATCAGCGATCTTCTTCGTTTCAGCTTCCTCTTTTCCAATACGTTCACTGTCGGC
TTCGACTTGTTTCCGCTGCTCGTCGGCAACACGGCGTTCAGAAACAATTACCACCAGCAGGTCACTGCAGTCCTTGTTCTTCTGCGCGACCACAATTTTG
CGCTGCTCAAGTTGTTTGGACATCTCTTCCACTTGCAATCTTGACTCTTCTAGCTTTGCTAGGCCATTTTTGAGTTTGTCTCGGGTATCGCGGATAGTGG
CTGCTTTTTCTGAGAGCAGCTCCACGTATCCTGTGACTAAAGACAAATAGTTAGTAGGAGTCACGTAATTGTGTCGTTTCATTCGGGCGAGGACTTGTGA
GGATGCAAGCATAACGCTGCTGTGTACCACAGCAAAGACCGCCGCAATCTTGGGACGTTGGGCTTCTACAGCCACGTTCTTCTCCTCTAGAAATTTCATA
CCAACTTCTTGGAGGGCATCTAGTGGCCATTCGTTGAACCAGTCAATGTTCGTATTGTTGACAAGCGACGGGAACTGCCGGCACCTGCTACAGAAGCCCT
TGCCAATCGGACTAAAGGCGAGAACAACGTGCAAGTTTCGACGAACTTCACTGATGAAGAAGTTCCAGAGTGATTCCTTGGTTTCACGTATACCTTGTGC
ACGTGCTCGCAAACGAACGCCATCAAGAATGCCGGCTTGTTCATCCTTCTCAAATAAGCCTGGAATTTCGCCGCTGCTCAGAATATTGTTTAGGTCTTCC
ACGAAAGACTCACTTTTGATCTGCGTATCACTGAACAGGAAAACTGTTTTCTGTTGCTGGATCCCCACCTGGGTATAGAGCTTCTTAATATCTTCATGGA
ACTCGAAGCTACGATAGTTCTTTCCCACTTCGATCTGGAACACCTTGAAGCCACCCATAAAAGCTGCAAGCTTCGTCAGCGACTGCCTACCACTGCCACC
AACGCCTACAAGCAGGAGATTCCCGCGCATTGTCATTAACTGCCTGTGAATACGCAATATATGCATAAGCGCGTCGCTGAACATAACGAGATTCATCGGC
ACAAAGCCTGGTTCGGCGTTGTGGTTCTCCAACTGTTCTTCGACAAAGCTTTTAAGCATTTTCATGTCCATAACCTCGGCATATCGAGCACTGCCCTCGT
CAGCGCCTGGAGACGTGGAGAAAATGTAAGTGAACAACGGTCCATTTTCTTTGAGCTGTTCGGGTGCTGACGACAGCAAGCGACCCCAGTCCGTCTGAAA
ATGGACGCCCAAGAGCTCATCAAGCCTCTTTTTGAACATTTGGCGATCTTCATAGCTTGTGAGACGATCCGAGAAAACACGCAAGCTCTCATGCATCCAC
AGCCTCAACATGCCGTCACGACTGGCTACGTTGTGTTTATCAGCGAGAAGAAGTCCTTGAATTACTCGAGCCATATCACGCAGGTTAAACAGGTAGTGAC
AATTTGCTGGGGTCGGCAAAAACTGTTCGAGCACATTTTGATAGAGCTGGATCGTCGCTGACACCAACGGAACACCAAGAGGCTTAATTTCGTCATCAAA
TTCGGCAAGCTTGGGCACGAGCATGGTCTCGAAGATGCGCTTGAGCTGTGCTTGCTCGGGAATCGTCATATTAATCAGGTTGAAGCGACTTTGAAAGCGA
GAGCTGATGACGGAACGTCCACCACCTGGAGGTCCCATCGCAGCAACAAATTGCATGTCTACAAAATACTTGAGCGTTTGCTTTTTGCGGTCGTACCAAC
AACTGTAGTCAACCCATTGTCGTAGCAGCTCCAGAGGCGGCTGAGATCCAAACAAGTCCTTGGTTGGCATGTTCATATCATCGATAAATGTTACGAGCTT
CTTGCCGCCAACAGGGCCAAACCTGTTCAGTGAACGCTTTTCCATGACATTTTCAATCATATCCTGAGTCGTTGCAGAAGAAGTAGCAGACGAGAAATTC
ATCACCAGTACATTATACGCATCACTCAGGGTTTCGATCTCTCGTTCAACGACGGTCGTCTTGCCCACACCAGTTTCACCAACGAGTAGTGTGTGAATGC
CAGCTGACAGCATTGTTTGAAGCAGAAAACCATAGCGCAACGTATCTATCGTAGGCACCATGATCTTATGGAACGGCGTGTTGGGTGCAATACGAAAATT
CGGAGGCAGTTTCTCATCCCAAAGCTTGAATTCGCGGCTGGACGGATCTACATAGAAGTCATACGCAGTCTTGAGAGGAGGATAAACAGAATCGATATCA
CGCAGGAAGAAGTCAAACTTTTTGCGTCCTTCTTCATTCGCAGCGGCCAAACAACCCCACGTCATGCAGAACAGGAACCATTTCTCGACAGCAGCGGCAA
ACTTATCTCCACACGTCGCTAAGTCGACACCATTCTCAGTCGTAGCCAGCGCGTTGTAGAGGTTGCAAAAAGACTTGACACTATTAAAGGTTGTAACTGG
AATTAGCTCCGTCACCTCCGATGTCTTGAACCTCAATACCTTTTCCATGTACTTGTCAAAGAGCGTCTGGAGCACATCACGCTCTTCCTGGATATGAATT
GTCGTAGCGAGCCATGTTTGAATAAAGGGGCGCCAACCAAGATCTTCGACATCCATGTATACCATTCCAGCACGACTGACGGTAGCTGGAGAAGCCACCG
CAAGATCTTGGACCTCGAACATGAGTGCCATTGATGGGCTCATGCTGATACGATCACCGTTAATCAGCGTTAGCACCTTGTTGTCATCCATGACACTGTT
CATACTTTCAATCCAAAGCGTGTCCACTGGTCCATCCAGCATGATCCACTTTTCTTCCGCTTTCTCATCCGCTGCAAGGTTTCGGAAGATAGCTGACAAG
ATTCCATCGATCCATTCAAACGTTGAGAGATCGTAGACACCATAGATTTCGTTCAGTGAAATCGATTTCGGATTCAGCACCTGTACTCGAACAGGCATAT
ATCCAGGCACACCTTCTTTTGCCATCCACGTCTTAGCCGAAAGCAGTGTTTTCCAAATTGTTGTTTTTCCTGCCATCGTTTGGCCCACGATCATGTTACA
GTGGCGAGTCACCTGTGATTCGTAGAGCTGGATCGTTTTGAACACAATCACCGGGTGGACCTGTAGCTTGTGCTCCAACAGCGCCTGCTCGATACTGCCC
TGCAACTTACCATAGTCCGTTACCGGTAGTTCAATCGAAGGGAACAAGTCCCCTAGCAACAAACGGAAAAGTACTGCGTCTTCTCGGATGAACTTGGGCA
TGTTCATGTCTCGCAATGCGCGCAGCAAGATGTTCTCCTCCTGCAAGTTTGGGTCTTCACGCTTGAGTGTGCCTGCCATGTTCAACACCGCCTTTAGACT
ACGCAGGCCGAAATCGTAGTGGTCCTGCTTGCTTAGCTGTTGGATCATTAATCCATAGAGCGTTGTCGTCTTCTTGGCCAGTACCTTTGCATCACGGAAG
CCTTCAGCTTGCAGCATAACTTCAGCAATTAGTGCCAGATCAGGTACCATCATGGCACACGGGCGCATCAGAGCTTTGAGGTTGTCAGGGAGTTCGGTAC
GGCCTGCGTAACCCGGGTTCATCGTGATAAATATGCCCATGTTAAAGTTGACTCTCATCAGAGTACCAAGGAACATAACCTGCGTTTGCCTAGCTGTCAG
TGCTTGCATGATCGTCAAGACCTGCTGTGCGACCACTGACAACACTTCAATCTCGATACGGTTGAACTCATCAAAGCATCCCCAGCCGCCAGACTGAACA
AGTCCTGCAAACATACGACCGACGGACTTGTAATCTAGACCGTCGCTGCAGTTGAAGACGATCACGTACTTCGCCAAATTCTTACCCAAGTCTTTCACCG
TTTCAGTCTTTCCTGTTCCAGCTGGGCCTAGGGGATTGCCGCCTCTGTTCAAGTGCAGGGCTGTTGTCATGGTGAGAACGCATCGATCGGTCAGTGGCGT
AATCACAAGTCGCCCGTTGTTGCCTTGGTATTCATAAGAATACTGCAACGACGTCACTGTCTGCTTGACTTCGCAAATGCCGACCTCACCCAAATCCTTG
TTGAAGTAGAAACGAAGCTGCATCAACCAGTCGAAGTCGTTCACACTTTTACAGTTTTGCTTAACCAGGCGATCTATGACATCACGCGAGTGAATCTCAA
TCGTGATGAGGGCCACAACTTTTTTGCGATCTGTCGCTGAGAGCTGACCGCGCACCATGTCAGCGAGCTTGTTTAAATACGAAACCCATTTCTTTTTCAA
CTGCTTCAGCGCTTTTTTCTCACCTTTAGCCACTTCATTCAGCGCTTTGATGCACTCGTTTGTCCAGGCCGTTTGACCACATGTGATCAACAGCTGACCG
GGAAAATCTTTAATCCACTTTTCTTTCTTGCCTTTGTAGCCCACAATGCATTGAGCAAATATCTTCTCCAGTGTGTTGACCATGGCGGCCTCGATCCGTA
GCAGCCACCCTTCCACAGCGCCTGCAACGACCACATTAGATGCAAACATAACTTGCTCGCCACAAGGTGAGTTCATTCCCAGAGCCTCGAACGTTGCATT
CCCGCGTGCCCCTGGGGGAATTAGGTTCAACGTCTTGATTGCTTCGAAACACTTTTTGATGTGTTTTTGCACTTGGTCCGGGTCCTTTTGATGTCCTAGA
ATCTCTAGCAAATCATCGTTGGAAAGAAAATAGAAACGAGGGAACAGCATTCGTTTGGTCTCAAGATACTGGTCCAGACATTTCTGAATCTGGTCCAGCT
TCTCCTGCATTGCAACGAGCGTTTCCAACACGCCTGCTTCTTGCGTAGCTTGCAGCGCGTTTTTCGTCTTGGCCATCCCTTCCGTCACTCGGCAGTAAGC
AGTGTTAACCTCGTCAAATAATTGACTCTCCAACGGTAACTGCTTACGGATATCCTCAGACGCCATGAAGATACTCTCCAAGTAGATCCAACACCGCTGC
ACACCAAGCAGCGTTTCGATGACTTCGGATAAATGGGAAAGCGCCTTCTCCCAATACAGAATGCGCGTATCGAAAGATCCGAAGAAGGGCGAAGCCTTCA
TTGTAGACAGTTGTACTTGATCGTCTTCGAGCGCGGTAAACAGATCGTC