Description :
From Genome Similarity Track
Location :
contig_103:19977- 22660
Transcript NameFunction/comments
g11037.t1hypothetical protein

Sequence
2683 bases(100 bases per row)
GCTGGTGGGGGCCATATAGACGATGGGTTTCGTTGGGGCAGGAGTCGGAGTGACGTAATAGTCATTTACACTTCTGGTCGCGGCGCTGACAGAGGTCTGC
TGGGGCTTCGTCTGGGCCTTCGCCTGCGCGTCGATGTAGTAGTTTGAGTTCATGTACTGCTCTGTAGTGGTAGTGAACGCACTCCAGCACAACACCCCCC
TTCTGCACAGCGAGCGCGTCTTCAATGAGCCTTCGACCCTGGGCAGCTAAGTAGCGGAACACAGGTCGGCATGTTTCGCGTTAGTGATCCCCACTTTAGT
CGAAAAAGAACGCGTAGTTAAGATGACAGCATTACCTGTGCGGCCTTGAGCACGGAATCCTTCCACGGCACTAGTGTGCTGAGAGCGAAGGCCAATGTGC
CCTGCCACAGCAATTCCACCATCAACGATGGTCGTGGCTGCAACAAGCAGTACAAATAGCTCCGTTAGTTGCCTCCAGTTCAGCTTCCGTGCAAGCAGAC
TGTTGTCCTTACTCGTTTCGGCGCGTTCCTTGCCTCTCTCCGAGGGACCCTCGACCTGCACACAACCCGCGCCTCCTTCCTGTTGCCCCACGTCATTTCC
ATCAATACCACGTCGCCTTATCCAAGTCAATATAAAAGCATACCTTCACTAAGTGCTGAGCGTTCTTCGGTGCTTCACACGGTGATCCTTCGCACCTTCC
GAACGGCATGTTCGTGATCACCAGTGGACGGCTGGCTCCACTATCAATAAATGCAACGATCAGCTACCCAGGAGCTCCCACGTTCGTCAGCAACACTTAC
CGCTTCACCGCCTGCGTGTGGTGGATGATGGCCTCCAACGTCATTCCTTCAAATGCGCCAACAGTAGTGCAACCCCATGGCTCCCCACTTGTGCGTTGGG
CCTACCGCGCCACCATGCCCAATGGGTCTCTAGCCAGCAGGATGTCAAGCCCTGCTAGGTCCACATGCACCACCGACGGGTCGTCGTAGGCCGTGACCAT
GGTAATGGCTTTAAGCTTGCGCTTGAAGATGTCGAGCGTCGGCAGCAGCTCGGTCACGTCCTTGGGCGTCTTCTCCTGCGTCCGTCACTGCAACCCACTG
TCATGCAGCACACAATCGTCAGTCTCCTTCTCCCAGCCAATCAAGTGGCGCTTCTCACCGACCGATTCGTGTCCTGCAGTCGGCAGTGGAGGCGACGCAT
GATGTTCTGAGCGCTCACGAAGCCTGGAGCCTCCACGACCCCCTCGAGCGTCAGCGGCCCCCATAGCAGCAGCAGCAGTAGCAGCAGCACACCTTGGCGA
TGCCGCAGCGGACACGGTCTCTTGGCGTTCTGGTACACGTAGCGCACGGGCTACTCCAGGAACTGCGTCCATTGACGCTTCATCCAATTAGAACTGGATT
TTCAACTTGAAGGCTAAGCTGGAAACTCGGCCTGGAAGCTCGGCCTGGAAGCTTGGATATGTAGTTTGGAATGCTATATTTATAACTATAGCCACCTGTC
GAGCATGTGATTGGTGGATGATCTAGATCGGACAACGAGGTGGCTGGAGCTCCACGACCGCTCCCCCGTGATCTACAGAGCCGTCCGACCGCATTACCAT
GAATCTGAACAGTGTTGTGCGAGTTGAACCCTGGTGGCGACTACGCAGTAACCTTGTGCTTCTTGTTGTAGACCTTCTCATAGCCGAACCAATCCTGATA
GTTCGGGTGAGTCTTCATGTCTGATACGAAGTGGAGTCCCAACAGCTTCTTAACTTCCTCTGGCGTTTTACCCTTCAGCAGCCAATACTTGTATCGCACC
TTCAGCGACAGCTTGTCGAGCATGTTCAAGATTGAGGAGCCTTTGATCGCCTGCCGAGCCATGCTCTCAACATGCGACGGCACTTTCAACAAACTCTCAA
GCTCACTTTGAACAATACCCACTCCCCTCTCTTCATCATGCGTGGCATCGCCGTCTTCGTGGTCCATCTTGTCCGTTCGCAAAAACCTTCTCGCAACGGA
GTCATTCTGGTCAATTGGCAGCATGCGACTCGATGTGGCCGAAGGCAGCAGAAGAGGTTGTTTGATATCTGCCGAGTCTGTATCAGCAGTTGCGACACGA
CAAACGCTGTCAACAGGAGGAGGTCGTACAAACGCATGGATGTATTGACGAGGATTGTTCTTCTGGCCTTGGAGGTTGAGTCGCGAAATGAGAAGTTTTA
GAGATGGGTAGCGCCAGTAAATGCAGTGTGTGGATTCCTATATACTGCCCAGTAGGCAGTGCCTACACAGCCGAGGATCCCGCAAACCGTATTTCCCATT
CTCCCTGAGAAGCGACACCCCCTGTCGATCCTAAGATCGGCTCAACCTCGCGAACGTAGACATAAAAGTATCACGTCCTCTGTGTTATTATACTTGATAA
CGACGTGCATGCGTCCAGCTGTGCTTGACATCAATGTGCATGACTTTCAGCTGATGGAGGAAGGAATCCGCCATCGAGCAATAAAATAAAGGTTTTGCTA
CTCACGTATGCATCCCGTTCCCTGTTTCAAGGCGACAAGGAGAGGGTCTACCACGACATGCAACGAGCATGAACGGCGTCAAACGCAGATAGCCACAGCT
GGAAATCCTTGCTATTAGACTCCCGAATCGAAAGATTGGGGGCAACTCATGATGGACTCTTGTCTAACTTCTGGTCTAACTTC