Description :
From Genome Similarity Track
Location :
scaffold_224:19969- 22997
Transcript NameFunction/comments
g5912.t1 conserved hypothetical protein
g5913.t1 conserved hypothetical protein
g5914.t1 DNA mismatch repair protein Msh2, putative

Sequence
3028 bases(100 bases per row)
GACCTACCTAGATTCTAGATTATTTCCTAGATTGGACCCAAAACCAACGTACAGTATGGAGTCTGGGAGTGGCTCCGGCGTGGCAAGGGCATCTCTGGCG
GGCTTCGTGTCGACGTCTGTGCTCACATCGTCTGATGGGGTGCGTTCTGTAACCCTGTTCTCATAGTGTTGCCTCCGCTAATGATGAATTGTACGTCGAT
AGCTCTTCGGCGACAATGTGGAGGAAAAACGTGTGACGGAGGCTCCGGCCCCGCGACCAGAGGACGCTTCAGGCTACAAGCCATTGTATGAGCAACTGCA
GGAACGTAAAGATCAGAAGGACAGCGAGTGGAAAGAGAAAAACAATCCCTTCGGTGCGTTACATCAACGGTTGTGGCTACTCTCGGTATCAGGGCAACGA
CTTATTGCTGATATTGTTGTGCCTTGTTGTTGCAACTGTGTAGCCCCACCTAAGGGTCTGGACGAAGAGGAGTTTGACTATATTCAGGATCTTGAGAGCA
AGAAGGATGACGTTGAACGCAAGCGCCAAGCACAGCACGAGGAGGACCTTGCTCAATTCTGTAAGCAACGAGAAGCTCTGCTGAGTATGTGGAATTGCTT
GGGAAAATCTAATGGTGTTGTTTTTGAAGTGGTGGCACGTGGAGCTCCTAAAGCTGCTGCTAGTGCGCCGCTTACAGCGCAGCATTTGCAAAAGTATCCA
ACAAAAACTAACTTGAAGTCGGCAGCGAGCACGAAAAAGACTACAGTGGTGGTGGTCAAGGCGAAGCGAAAATCAGGAAAGGATAAGGCGCACAAAGGTG
ATAACAAGACGGTAGAGTCTTCTGATAAGCCAAAGGATGAGCCTCTAAAGAAGAAGCAGAAGGTGAAAAAGAGTAAATCCCCGACGCCTACAAAGAAGTC
GAAAGCAGCAGCGTTTGGACTTGTGGCGTACGGCAGTGACAGTGACAGTGACAGTGATGCGGATGAGACGAGCTAGCAAAGCTGGATTAATTACAGTAGA
TGCCTTTACTTCGAAGCGCTTCTGTGCCTTACGTCTATTACCGAAACAAAGGAGGAGGGTTGGAGCCAGGACGTGACGACTTCGGCTGAAGAAGACGAGG
TGCTGCACTGTCTCCATTCGGCCTGCGTAGTGGAGGCGACGCTTCTACCAGGACTCTTCTTGTAGTTCGTGCTGCCATCCTCTTCGGTCTATCGGGCGTA
CGCATGACTACCGATGAGGTGGTTGCTGCTCTGCGTAACGGCGGTGACTGGTTTTTGCCTGTTGTAGCTACCCCTCCAGCTTGGACGGTGGTGCCTGTTG
ATGAGGACACTTTAAATTGTTGTCCGGTGAAGTGAGAGCGCTCCGAAATGGCTCTCTGAAGGAAAGGTGCTGCAGGTCCTCTCGTGCTAGACAGCATGGC
AGCGCGACGCAACAAGTCGGTGTCACCAGGTTTTCTGGTGCTCGACGCTGAGCCAGTCTTGGCAAAGTCTAGCGTCCTCGGTTTGTGTGTCGATGTCGAT
CCAGTTGCCGCTCGAAGCAGTGAATCTTGGCTAGATCGTACTGTGCTACTGCTAGCACTGCTGGTTTTGCTGGAACTGCTGCGGTGGGTTTTAGAGACCC
GTCTGGACTTTCGAGGTCGTGACTGCGTGTGCTTCTGCTGCAATTGATGTGGAAGTTGGACTTCTTTGAACAACCCGCTTGTATCTGGGCGAGCCCGCTT
CGCCGGTCGTTCTTCACGCAATGCAGACAAAATACTCCCCTTCAAAGTGGACTCGACAAGAGGGGGCTGAGGGGGTTTCACAAGTGGTTGCAGCTGAACA
GCACAGTGATCAGAGCAACCAAGTCAATAAACCAGCACTCAACAAAGTACAGCGAAGACTCTTACCGTAGGTAGCAATGAATTTAACGCATCGTTCTCCT
CAGCATCCTTAGTCTCTTCCTCATCCTCCAGCTCATATGCTCGTAACAAATACTTCACGAGTTCTGGCAGTAGCAGCTGAAATCTAGTAGCCAACTGCAG
CTGCAGGAACTCCTGGAACGGCGATCGCTCGTCTTCGTCCGCCAAGGACGGAGGATTCTCTGCGTCTAGCAGCAGTGCCACGCGGTCCAGTAGCCCTCGG
ATCTCCTTCTTCAGCTTCTTCCTCTGCTCTTTGTGCTTTTTGACCAGAGCTCCGTACCGCAACATGCGGCACACGAGCTGGAGCTGCAGCACTCGAACTT
TCGTGAACTTGTTGCTGCTCACGGACGCATTTAGCTTCGGCAGCTCCACTATCAAGTTGCCGGCCACTGCAGCCAGCCGCTTCTTCATCGCCCTAAGCTG
CTTCCTGTCGCCTTCATCCAGTGCAACATCCTGGCTATCACTTTTCTTGGTCTCATCACCGTCACTCTTCTTGGTTGCACGTTTGGCTCGGCGACGCAGC
TTGGTCCACCATTCTCCGTCTTCCTGAGCCAGCAACAGGTCCAGAAACGCCAACACATTGTTCACAGGTGTCTTGACCGTCTGGTGCGTGCCCGACGTTG
ACGCAGAAGCGCCTCCTTCGTCCTCCAGAGCGACCACCTTCGCATACTCCGCCTGCCAATCCGTCGCCATCGCTGTAAAATTCCAAAGTGAAGCGTCTCC
AATTGCGTACCTCTTGGTTTTTGTAGTGAAAAGAGACACTTCCACCGGGACACAAAAAGCGCGGGGGCAATCTGAATTTAGCGCGCAATTGACAATCACT
CTGGATAAAGCCACGAAGAGATGGACCGTGAGGACGAAGACTCCGCTGTGGAGACGCTGGGCGAGGCGCAGGCCGAGGTGGCGCTGCAGATCCGCAACGA
CAAGCATCTGAAGCAAGTGGGGGTGGCAGTGCGTCGGCCCCGTGCGCGTAAGTCGTGCGTTAAGGGCCAAGCGGATGAAGACACTAAGCAGTGGGAGCTG
CTGCTCTTCTCCTTCTCTGATTCTAGCGAATTGGCCAATCTGGAGTCTCTTCTACTACAGTTGGCGCCTTCTACATGCTATATTTCTGCAGAACTGGAGC
AGACGCAGGGCCTGGGCGACAGTAAGAA