Description :
From Genome Similarity Track
Location :
Scaffold_160:199666- 202850
Transcript NameFunction/comments
Aphin_H310_12323Hypothetical protein

Sequence
3184 bases(100 bases per row)
TCGCCGCGAACGAAAAAGGTCGCGGTGGTGCGGGATCCAGACATGACGAGTGTCCTGTCGCCGCCCACGTCGTACAATGTATATCCGTTCCAAGGGCTCC
AGTCGCCCCCCAAAGCCCCCCGCACAGACTCGAAAACGTACTGGCCCGGTCTTGAGTTTTCGTCTCAACCTTAGCTCGTCGGTAGACCGCCCAAACGCCT
TAAACAACTGGACAAGCCAGCCCTGTATGCGCTATACTCCATCTGATCTCGAACTCTGACATGGCGTCGTAGCTCGGCCGTCCATTCGTGGCTCCCTCTG
ACCAGACCGTATTCCCCCTTAGGGGCAGTGTCCCCCACGGCTGTAGTGCACCACTTGAGCGAAGAGCAGTACCCCCACGTCAAGCAGCACGACCTGGCCC
AGATTGAGGACTGGCTCGTCGGGTTTGAGCAGGAGGCGCGCTCGTTCACGTCGTACTTTTTGTTTTGCGAGCTCAAGTTTCAACAGTCTGCCGTCCTGGC
GACAGGGCGGGACGTGCCGAATCGACTTCGGACTGCCGTCGCGTTCTACTGCCTCCAGCAAGCGTCGTCCATCTTTGGGCGGTACCAGTCCGTGCTGGAC
ACGATCTGCTTGTACGACAGTCCATTATGGATACTCTAAGACGCTTCTTGTGTGCGCAGGAACTTGGGGTCAGCGATCTACACAAGCTTTGGAACACTGC
GGCGCGGCCGCCACCTCACAGCCCTGGAGTGCTATCACGCCGGGGTAACCTACTTTGATCAAGTCCAGTCGCTCCAGCAAGAAAACGCCCAGCTACAGTC
TCGTACGAGAGTCCCGTGCTGCGCCACGTCACCCTTTTCGTTCGTTCGTCCAGGCAAATCGTCTCTCGACGAGTTGCTCGTCCGACTTGAGCAACGGGTG
CAGCAACTTGAAGCCGAGAACGCAGCATTCAAATCAAACCCAGGCCACAGCACGGTCCCGGCATCGAACACTGTCAGCGCCTTCACGAAGCTTGCGCTCA
GCAACGAATTCAACCCTGCGGCCAACATGGAGCAGCGGGAAAAGATGGGGTACATCCTCAAGACGTTCAAGGCGCTCGATGCCAACGAACGGCTTCAAGT
CCTTCTAAGCCAAATGGACATGATCGGCGCGAATGCAGACATGTTGCTTACAATGATCCACGCGCTGCCGCCTCGGGAGCGCAACACCCTGCTCGATCGT
CTCGTCCAAGACAAAGTCCAAACGATGCAGTCGTCCGTTCGACAACATCTTTGCTAGAAAAGACAGTTGCTGACACCGCGTGTATAGGACATGGGCGGCG
GAAGCCGCCGTCCGGGGTGTCCAACAGCAGAACGAGGACGCGAACCAGTACAAACATCGCCTCATCAAGTACCAGGGATTGATTCAAGACGTATTGGCTG
GGATCCACGTCTCGGCTCTCGACATTCCACCTCAGGACGTACGTGCAAGTCCATCGACCTTTTCCCGCGCCGTGCCTGCCACGGAGCACTCACGGTGGCG
CTGTCGGGTGTGCTTAGAAAGGAACGATTGAGGCGCTCGCGAGTTTGGTTGAAGCGTTGGCGCAGGAAAAGGACAAGGTGAAGCGATACGAAGCCCGCGT
GTTTGGCATGACAGCGATCCATGCCAAGAACAAAGCAGACGTGGAAGGATCATGGATGCACAAGTGCCACGAGCTGCAGGCGAAATACGACGCAGCGGAA
GCCGAGCGCGTGCAACTTGTCCAGCAACTCGATGCGGTCCACGAACGAATCGAGGCAGAGCGAGTCGAGCGCGCCGCGCGGCCAACCGACACGAACGACA
AACAGACCCAAGTTCGTCCGGACGAGCTGCAAAAGTCTATGATGCACAACGCCGACAACAACGAGCGCAAGTTGACGCAACTAGGGTTCAACGGATCCAA
AGGCCATAAATCGTTCACTGGTTTGGCTAAACTCGTGGAGCCGTTTGCAAGCAACCAGTTCCATAGGGTTGTACATGATGATTCAAGAAGCCAACTACTC
GGTTGCGAGTGTCAAGCGTATTCTGGCCAAAAAGCGGCCTCTGAGCATGCTGGAGCTCCACCAAGTCATCTCGGGGTTCTATCAAACCAAAATGAGCCAG
GACATTGCGGACGACAACATGCATCGTCATCGCGAAGGTTGGTCGGCCAGCATCGTGTAAAGTCGATTGTCATCGGTCTTGTGACGGCGGCAGGGCTAGC
GCAAATGCTGCTCGATTCGTACACGGTGTACTATGGACTGCGCGAGTTGGCCATGGGACAGCTCATTACGCTTGACTCGGCCATTCGAAAACACGCCGGG
GTATGCCATGCTGCCGACTCCCTCGGTGCACAGAAACCTCTCGACGTAACGACTGCTGCCGGTGTAGAAAAGCGCACGCATTCGACTGTTTGGATTGCTG
GTCGGGTCCCTCGAACCAGGAAGCTATGCGTCGTCCGCCCCAGCCATTGACTTTTTGCTGTTTGTCGTCGGGGTGCTCTTCAACGGTGCGATATCGTTCG
TTCGTCGCACGTTTGGCTCCGTCCTTCTTGACGACGCGAATGACGTAGTGGGCAACTACCGCATGCATGAAGAGAGGGCGCAAGCAAACGCCAAGCAGCT
GAAAGCGTGGTTTGGCGACGGCATCAGCGGCAGCCAGAACTGCACGATGATTCCACTAGGTGGACAAACCAACGTGAATCAACGTTGCCGGCACTCAATT
CCAACTGTTAGACAAACTCATTCAGACGGTGCAGACTGTGTTTGCGCACAGCCACGTCACGATCGCATTCATGCAAGACTTGTGCCAGACCCAAAACGAG
AATGGCGACGTCGACCTCGACGTGGCGCTCGAGAAAATCATGTACTACTGGCTCAAGCTGTACGCGGAGCAGATCGTGACGATGCACAATGTGTTTGAGC
TTGGGGACAAGGACACCAACGGCGTGTTGGACTTTTCAGAGTTCAGGTACCCCTGCCGCCATCACCGTTGCAGGATGTGTTGACGGCTGCTGCGTAGCGC
TGTGGTGCACCATCTCGACCCAGACATGACTCGACGGGACTGCCTCGAGCTGTACAACCACGTCGCAGGCTCGGACAACGTGATCGACAAAGAAGAGTTT
GTGATGGGCATGATTTTGCACCAGCGCGACATCGGGCTCAAGTCGTACTTTGCCGCGGACCACGCCGTCATCGCTAGCTCCTCG