Description :
From Genome Similarity Track
Location :
Scaffold_20:19960- 23437
Transcript NameFunction/comments
Phyke_g1240hypothetical protein
Phyke_g1241ABC transporter ABCF family

Sequence
3477 bases(100 bases per row)
AATGAACCGCATTTTCGGCGCTAAGAAGAAACAACCCGAGGCGCCACCCGTCAACATCTCCGATGTAGGGGGCAAGGTGGACGCGCGGGTCACAGATCTG
GACATGAAAGTGCGTGTCGCTAGCTGTAGTGTCATTGGCTTGTCAACCCTTTTAAGTAACAGCTTCATCGTTATGATCTGTTGGTGTTACAGATTGAGAA
GCTGAACGAAGAGCTCCGCAAGCACCAGGCACatatgaagaagacgcgggGTCCAGCACTGAATGCCATTAAGCAGAGAGCCATGCAGACGCTTAAACGC
AAGAAAATGTTCGAAGCCCAGCGCGACAAACTCACAGCCCAGTCATTTAATATTGAACAGGTACACGTATACTAGGTTTTGGCTGGTATAGTGCCGACTT
TTTTTAAGTAGAAACTGACTCATACTGTGTGAACTGAAGGCTGCCTTTGCAATTGACACATCAAGAGACACAATCACGACGGTTGCTGCAATGAAGAGCG
CAGCTGTGCAGTTGAAGGCGGAGACTCAGAAGATTGACATTTCAGAGCTGGAGGTGGGCATGCTGTTTTTaaagagcaggagcttcgCAGGTTGAGTTGA
TCTGATGGGTTGGTTACCggtttgttgttgctcctACTGCATTCCAGGACGTACAAGATGACATGGCAGATTTGATGGAGGATATGAACGAGATCCAGGA
GATCATGGGTCGCTCTTATGGGTGCGTTGAGGCGTTATCGAGCAGCGCGATGTGCGCATACTGATACGGTAGCTGCCGGTTTCTGTTGTTGGCGCTTATT
TTTGTTTTAGCATCGGAGACGAAGTTGACGAAAGCGAGTTGGAAGCAGAACTGGCTGGTCTAGAGGAAGAATGGGCCGAGGAGGGGGCAAACGAACTGGA
GGCGGAGCAAGCGCTGTCTTACCTGGCACCGGCACAacagcacgagctgccgGCCGCGCCCTCAGGTACTTTAGACTCCGGCAGGATTGCCCACATGACC
GACGACTTCGGGCTGCCCATTGCGTCTACGCCGTACTCCGCCTAATAAGATTCGGTGCCCTGGGAAGAACTGTAACAGAAGAATACGGCGACAAGACATA
TATATCCGCAGTAGTCTGCATCGTGCTAACTGGTTGTTTCGCTTGGACTCATCGTGCTGACGTACACCTTTCGCTCCCATTGGCGGAGTGTGTCAGCCAA
TCATGTGTCAGTCATATATCAGCCAATCATTTGCATAAACCTGTCCAAAGCATTTTTACGGGTTGACAATGTGTTATATTAGGGTATTTAACTTTAAAGT
GTTTTTCCTTGTTAATGTCAACATGTCGTTGGTATGAAACACTCCTAATACGTATTCTCACAGTTGTAAGGTTTTAGTCTATGAGGTTAAACGCTGGCCA
ACGCATGCGGCCTCTGGTCTCATTATCGTATTGGTGGTAGCAGACCGCAGCCGTTCGTCTTCCAGTAACCTCCCAGATACACTTCCAGTTGCTACATCAT
GCCGCCGCGGGTCAAGAAAGAGCGAAAGGGCAAGAAGGAGTCGCGCAAGAAAGCGgccgaggagaagaaggccgcGGAGAAGGCCGAGGCGCTCGAGAGC
ATGTCCCACGCCGACCGTCTTGCAGAGGAAGGAATCATCGCCACGTGCTCGCACAATGTGCGCTCGGTGCACAAGAACTTCAAGGATATCAATGtgctca
acttcagcatCACATACTTCGGTAAGGTGCTTATGGAGGAGTGCGACATTTCGCTCAACTTCGGTCGTCGCTATGGTCTCATTGGTCTCAATGGTTCGGG
TAAATCCACCTTCATGAACGTACTTGGTGCTCGTGGTATCCCCATCCCGGATAGCATTGACATTTACCACCTGAAGCACGAGATTGAGGCCAGCGACATG
ACGGCTCTCGAGGCGGTGCTGTCCGTTGACGAGGAACGTAACAAGCTGCAGGCCGAGGCCGATTTGCTGTCGGAACAGATGACCGATGAGTCactggacg
aagaggacagTGAATCCATCTCGGACCGTCTCACAGACCTGTACGAACGTCTGGATGACATGGACGCAGCTACGGCTGAAGTCCGTGCTCGTCAGATTCT
GTCGGGTCTGACATTCTCAGACGCCATgatgagcaagaagacgaaggagtTTTCTGGTGGTTGGCGTATGCGTATCGCACTGGCTCGTGCTCTGTTCATC
CAGCCCACTTTGTTGCTCCTCGATGAGCCGACCAATCATTTGGATATGGAGGCTGTTGTCTGGCTCGAGGACTACCTGGCTCGGTGGAAGAAGATTCTTC
TTATGATTTCTCACTCGCAGGAGTTTATGAACGAGGTGTGTACGAACATTATTGACctcaccaacaagaagctcgAATACTACGCTGGTAACTATGACAC
GTACGTGCGCAcgaaggctgagaaggaggagaaccAGATGAAGCGTTACAATTGGGAGCAGGACCAGATCAAGCACATGAAGGAGTATATCGCCAAGTTC
GGTCACGGTTCCGCTAAGTTGGCACGCCAGGCGCAGAGTAAGGAAAAGACGCTCGCCAAGATGGTGCGTGACGGTCTTACGGAGAAGGTCGAACATGAGG
CCGTGGGTGACTTCAAGTTCCCCAACCCGGAGAAACTACCTCCTCCAGTGCTTATGTTCCAGAACGTAGCTTTCGGATACCCAGACTGTCCTCTGCTGTA
TAAGGGTGTGGAGATGGGACTTGACTTGGACTCCCGAGTGGCTCTTGTAGGTGCCAACGGTACTGGTAAGACCACGCTGCTGAAACTCATTACGGGTGAT
CTGGTGCCTGTCGAGGGTAATGTTCGTCCGCACAGCAAGCTGCGTATTGCTCGATTCAGTCAGCATTTTGTGGATGTTCTGGACTTGGAAAAGACACCGC
TGGAGTACTTCCGTTCGCTGTTCCAGACCAAGTCGGTTGAGGATGTGCGAAGCTACCTGGGTCGCTACGGTATTTCTGGTGAGGTGCAAACGCAAATTAT
GGGTCAGCTTTCTGACGGACAAAAGAGTCGCGTTGTGTTTGCGTACATGGCGCAACAGAATGCCCacatgctgttgctggatgAACCGACGAACCACTTG
GATATGGAATCCATCGATGCTCTGGCGCGTGCCATTAACAACTTCGAAGGTGGTATGCTGCTGGTCAGTCACGACATGCGTCTTATTTCGCAAGTGGCTA
AGGAGATTTGGCTCGTGGAGAACCAGGCTATTCGAGTGTACCAGGGCGAGATTTCGGACTTCAAGATGCGTGTGCGTaagcagctcaagctggcggacaa
gGAACCAGTCAAGGTCGACGAGTAATTTTCTCGACTCATCGTTCATTAGATGACCGTTACGGCAGCACCATGTAGGTTAAAAACTGCAGTAGCTTTCGCT
CAAGCTCTGGCCAATTCATATTTGATTTCCTTGCCGACGAAGCATAGATTGTGAAGTAATCACACGTTGGTAGTTGA