Description :
From Genome Similarity Track
Location :
Scaffold_219:199591- 201782
Transcript NameFunction/comments
Aphin_H310_12712reverse transcriptase

Sequence
2191 bases(100 bases per row)
CAAAAGTGAGTTTCCCTCCGCTTGAATCCGTTCTTCGACCTCTTTGATGAGTTCAAGGATGTATCCCCCGACGACGTCTCTTGTCGCCTATCCGTAGACA
TGAGTATTTGACACGACATTGACCTCGTGCCCGGCACGAAATATTGCGTTCCTAGCCAATGGCCGCTTCCACGTGATCGATTTGAAGCGATCCAAGCGTT
CTTCGTGGCTCGTAAAGCATCAGGATGCGTACGTGAAAGCACGTCCCCTCACAGCAGCCCGACGGTCTGTTTGAAGGAACCTAACGGCAAATGTCGTTTC
GTACACGTCTTTAACTAGCTCTACGCCGCTACAATTTCGGTGCAAATACCCATTCCCCGCAAAGGGGGGAATGGGTGTAAATAATCAGTTGTAATTATTG
ACCACATGGGTCGATTCATCATATTCTCTAGCTTCAACAGTGCGATGGTTCCATCAAATTCTCATGCGCCGCCTGCAAGGTGCAGAAGACCTCCGTCTTG
ACATCAAGAGGAATGCTTTGGAAGATGCCCCAAGGCCTATCCAACGCCCCTGGAACATTTAATCGCATGATGACGGCCAAGTTCCGCCCTCTCCGCGATT
TCGCCCCGTAATATTTTGACGTCATCTGCACGCGTAGTCGCGGTTCTGAAACCGAGACCGACCTCGACGTTCACCGTTGGCATCTTCCTGCGGTCCTTGC
TGTCTTTCGTGAGAATGGCTTGCATGCCAACCTCTCCAAATGTTTGTTTGGGATCGACGAAATCTCTGTCCTTGGAGACCTCGTCGGTATTCACGGTTGC
CAGGCTGATCCCGACCATTGTATTACCAACCTTCGCCGGCGCCTTGCCCTGACTACCTACTTCCACAAGTATTCTCGTGGTTTTGCCGACATCGTGCAAC
CCCTCATTCGGTTGCTCGTCAAGGATGCCCCATGGGTCTGATCGAGCGACTGTCAGCTCGCCTTCGACGCTCTCAAATCCAACATCAAGAGTGCCCATAT
TTGGCGCTTACGGACTTTTCCAAGTCGTTCAGCGTCATCTGTAACGCTTCCCAGTACGCCATCGGCTGTTGCGTAATGCAACCTGATGTAGATGGTCGCT
GACGTCCCGTGTCCTTTCAATACCGCCAGATCCACGCCGCCGAGCGTTCGTACCTTGTCCACGATCTCGAGCTCCTCTCGATCAAGTACGCCCGCACAAA
GTTCAGCGTCTACCTCATCGGCGTGGACCCCTTCATCTTTTACACTGACCTTGCGTCGTTGCGAACTGCCGTCAACACGCCCCACATGTCAGCTCGCATG
ACTCGCTGGCTTTCCATATTCACCGAATACAACTTCTCGTTTCAATACAAAGTAGGCAAAGACAACGTCCTTGCTGGCGCTCTCTCTCCGTGTCCTGACT
ATTCGTGTCCTTAAACCTTGCCTAGATCTGTTCCATCCACTTCGATCTCCATGTTCGCATCCGAGCCGCCTACACCCTCGACACAACTTGATCGACCATG
TTCAGTGCCCTCACCGCCCTGAACCTCCAAAACCTCGGCATTCACCGTCCTTACTCCATCGTTACTCTGTTCACGATGGCCTGCTCTTCAGTCAACCCAC
CCAGGACTCGCCCCCGCGCATTGTTGTCCCTTGGGATTCTGTGATTTGTGCATCCCTTCGGCCCGCGTATCATGTTTCCCCCAGCGGCGGCAACTTCGGC
CGTAACAAAATGTACCCTGCGTTGTCCAGTTCATACATAGTGCATTGACAAGCGTCGTATCTGGCGACGCATGTCAACGCACTAAGACCGCGACTTCCTC
TAAAGAGCTCCTACACCCTTTGCCGGTTCTCGATGAGCACTGGTCAGCGGTAGGCATGAACTTCATGTTTGGCCTCCCGCGTGACGCTCGTGGTCGCACG
GGTATCATAGTTTGTGTGATAGGGCGTCCAAATACATCATGGTCATCCCAGTCAAAAAGTCTATCAGCGGCAAGACGCAGCTCGCCTATTCTTCGATCAT
ATCTTCTGTTGCTTTGGTCTCTTGCGGTCCATCTTGTCGGTCCATCGTGTCGGACCGCGACACCCTCTCTTCGTCTCACTTCTGGTCGGCTCTGTTCGAC
CTCTTTGGCACTGACCTTGCCATGTTTACGTCCGACCGCCCCGATTCTGATGACCATTGTTAATGATGTGATGATCAAGTGCTGGTCCACA