Description :
From Genome Similarity Track
Location :
Scaffold_208:19955- 24776
Transcript NameFunction/comments
Hyaar_Emoy2812616predicted protein
Hyaar_Emoy2812617predicted protein

Sequence
4821 bases(100 bases per row)
ATGTGTTGTACGTGTGCGTGTCTGCGAATAACGCTAGATGTACTTTGCACGTCGTACTAAGTGCGATGTAGCACGTCGCCTTCTGATAGGCTGATATGCA
TAATAATTGTCGCTCGTTGGTCACGTCATTTGCGACCACGTAAAGTGTTTATCACATACACGCACCAAGGCCCGCATGTGATTGGCTCAAAAGCGATGAG
GGGCGAACAACGGTAAAACAAGCAAATGCTAGACACTAAGGGGCAGCAAAGTCTCGCACCTTTCGCAAACAGTAAGTGTGAAGTGATTTTAATCTGCATT
ACTTGACATACTCGAGTTTTGAGAGGTTATGGTCACTTTTGTCGCTCGGTAGCGGTGGAAGCTCCATCCATTTGATTCCTCTTTAATGTAAATAAATTAT
ATGTCGTCGGCCGCATTTTTGTGGTTGACGGCGTTACCAAGCAGGATCATCCTTCGTCTCCCTTCATTCACATTCATCGCTTTAGAACATCAAAAACATC
AACCAGTACCTTCAACACGGAATGGTATATCGACACTTACATCTTTAACACACAAACACAATCAATTTTCTAGCCGCTAACTACTAGAAATGGAACGTGA
ATATACAGAACTTGATTCAGTTCCATGGACTGAATTGCTTATACCGAAGGGCGGTCTCCAGAGATTGCTCCCCCATCTTAGTTCTGTTTTGTTTGACGTC
ATATTCGATTACAGTGCGTACTTTTCAGCATTGGAAAACTTATGGAGAGAACTTGCAGGATGATGAAGCTCTGCCAAGGACTTCCTCTTGGTAATTTTCA
TTCTTTTTTTATGGCTTCAAAGATGCTTGCCTGGTGGTTTGGATATTGTAGTAGGAGGCATCCCACACCAAGTTTGTGTGCACCAGCAGTAGCGGAGTAA
TGCAAATGCATGCCAACGCATTGAAATCGGTACGTTTTTTTTCTTCATATTTTCATTTCCTAATTTGGCCATATTTTTCAACAACATCAAATATAAACTG
ATAATAGCTTTTTGACCTTAAAGGCGAGTTTGCACAGGATGCCTTCTTTGCGATTTTTGAATTTACTGCGAAGCCTAAAAAGGAAAGCTATAGATGATTG
AAATACGCACGTTTTATCGCGTGAAATAGGCTTACAAGTGTTCTGTTAATAACATTGTTGTCTTATTTCTTGCCTTTCGTAGATTACAATGTTCAGCTAC
CACCCTAACCGAAGCGTTCGGTTATCACATACGTTTAAGTGTTCAGATTTTAATTTTTTTTTTGAACTTCTTTCCAGCAGTAGTGTCTTATTAAAAATCA
CAATGCACGGTTTTGTACTACCTTTCTGCCTTTTCTTAGGTCCTTTATAATAACCACAAGCATCGTGCCTATGCTAGTAGAGTACGCAATTAACTGCTAC
TAAGTACAAGTGGACGCGACTAACTTCAGTTTACTTGCAGGTTTGTTAATATCCAGAAAGGACTATCCCTGCTCCCACCCTTTCTTCTTAAAAAATGCCA
CTTTTCGTCATTTTATTTCGATCCGAATTGCTGGATGGTCTATGATCATTTTAGTTTATATTGAGGTTAGAAATATGCCGCTCGCAATTGAGGCACATCT
AAAGACGATTGCCGATAAGTATGACGACGTTTCCGATCATCAAAAGCTTCAATATACTTATTGGGAGCCCGAAGGGTGAAGCTATTAGTGAGTGTGCGCA
GGGTTGAATGCCGAACTTTTACATCGTACTTATCTGTGTGTCTGTAAATAACGCGGTTAGGTGTATTTTACACATACTAAGTGCGATCAATTGTGACGCA
CGCACCGGATTGGCTTAAAATCGACCAAAGGTGAATATGATCACATAAGCAAATGCTGGACGATCATAAGCAAAGGCCGATCGCGTTGCATGAGTATATT
CTGGGTTAATTTAGACATTAACAGCATCATACTCCTTCTTCAGTGACTGCTGCTGTTGTATAGAGTTTTGTAACTTAATTCTGTTCTCCGAACTGGATTA
CTTATATCAAAGGGCGAGCTCCAGAGCTTGCTCCCCTATCTTATCTTAGCAGTCCCTTATGCGTACAAAACATAAAAGTAAGCAATGTGGTGGGTCTGCA
AAATCAACGTACGCGAGTTCCATCTCACCTTGAGCATGTTCATGTTACGTTGACTACTTCCTCAAACGCCAAAATTGTCGGACACGTAGAGACATGCTAC
CCTGCCGAACCTGAAATCAAAAAGAAATAGTACCACCATAGCAGGTCGTTGATCAGACGAGTTGTACGTGTTGAAGTGCAGTACCTATTGTGGAAACATA
ATGTTCGGTCCTTTTACATATAAAGTTCCGATCCCGTCGCTGGTTCCCAGAATATGCGGCCATGATCTTGAACGTGAGTCGATCGATTAAAGGGCAGCGG
GGATGATACGATCAAGTGTCGAGGTTATATTATAATGTATATGTTTACCTGTTTGGAAATGGTCTGTTTTATAAACAACACAATCTATTCCTGATATTGT
TGACAAATATTGCGGTCCTTTTTGTAGCACTCATACCTCGGTTTTGCACATTCCAACTTACGATGTGAACCTCCCAAACAATCGAAAATTATCACGCCAT
ACCATGCAGTTGCTCTGCGAAGTGCGCACATCAATAAAGAAACGTACTTCACTGTCACGTGCAGCACCTTTATTTGGACGGCCGCATCAACTTCGACGTT
TCGTCGACATATTTCACTGGTTTTGAGCAGCTCATAAAAACAACGAAAATGTCACCCGACGAGGAGTCACAAAATAGTAAACGTCAGCCTTTTGTTTGCC
ATGGTAATATAAATCGTCAGCCTTCTGTTTGCCATGGCAATATAAATCCTAGGTGAATGCGATTCAGTATAAATCTATAGGCTCCATTCGAAATGCTCCT
ACATATCTGTCAGCATAAAACCATTTCTATCCGCATCAGTGAAATCAACAGAAACCCGAAACATGATGAAAGACATTAAACGCTTAAATCTGAATCCATG
CGATGTGTTCGATTCGTTAGAAATCGTTCAACCTGCATGTAAGTGTTTTCTGAGGGGATACAGTCACGTTTCTATCACGTAAACCCACTCAGAAAATCGT
GCGAGTCAGAAACCCGCCTAGAAAAAGCCCAAACCCGCTACTTCAGAAACCCACATCAAACAGATACGAACCGGGTCCCACTTCAAGTTTGTGGACGTGA
CCACCGCGTCCAGACCCCCCTTTCGCTCCAGTCATGAGCGATGAAGTATTACTAGGCTACACTGCTGCCGTCGTCGCTGTTTTCTTCTTCGGGACGTGCT
ACGTGCCTGCGAAGACGTATGCTACTTATGGTACGAGGTGGTGCTATAGTGTACAAGACTCCCTTTTCCCTCTCTCTCTCTCTTTTAAATCTGTATTTAG
TGTCTGACGTGATGTTTTATGTGGTGCACACAATCTGAACTTTTGACAGATGGCATCATCTTCCAGTGGTTTATGGTACGGATCCAAAATGGCTACATGC
TCAAAGACAGCTTGCTGTATCCATATACAGTACTCTATCCCCTCTCTGCTCTTTTCCACCAATCAAAACTCGCGATGCGAGTCAAAGGAGCAGTTCGGAT
ACCATACCATACCACTTCAACTTCAACGTCAAGTCTCCCCTGACAATTATATACCTTTACCTCTCTCTCTCTCTGTATGTGTGTCTTAACTGCAGTGTTC
CGGGATCTTAATGGTGGGGATTGTCTGGGGACTCCTCAGCAACAACTGGTCGCAATACTCGCACTCGGGCATGTTCACGTTCCCCGAAGGTCTTTTAGGG
GGTGCTCTATTTGCCATCGCCAATCTCCTCATTCCCACTGTGGTCAATACACTCGGTCTCGGTGTTGGCTTTATGCTCTGGAACGCTGCCAACATCACCC
TCGGCTACTGCGTCTCTCGACTCGGACTCTTTGGAGTGGCACCTACGATTCCGTCCATGCCGTTCATCAGTCTATTGGGCATTGCCTTCATGCTGGCATC
CATTGCTGTCTATGGCACTATCAAGCCAACGCTGAATGCAGCCAAGACCGCCAACATAAAAAAAAGAGGCAGGAAAGATGAAGATGAACCAGAAGTCGAG
ACCAAAGTGCATTGGGGCAGCAATGGCAGCAACGGGAGCTCAGGCAGTCCAGCTGGAGAGCGCTCGTCTTTGCTGCCGCAATTTGCAAAAAGCGCGGAGC
TTACAAGTATCACGCTTACTCGACGTGAGTCACTGCATGAAGCACTGGTGCACCCAGAACTGCCCAATTTTGGACCGTTCATGATGCCAAATGAAGTCGG
GGAGCACGTGGAATTGGCGGATGCTCGCGCTGAGCAGACGCGCAAAGTCTTTGGCATGACGATTGCAGTGCTTGTGGGCGCGTTCTTAAGCTGCTGCCTC
GTGCCGTTTGTGAACTGGAACGACCGCTGCCGCCCGTCGGACCCGGCGCTCAGTAGCCCCATCGAAGAGACGTGCAATCCACTGAACTTTGTGTTCTCGC
AGTGTTTGGGCATCTACTTGACGAGCACGATTGTGTTTTTGCTGTATTCGCTTTTCCACCGATTCGTGCTTAAGCGATCGATGCCCCGCAGTGTGATGCG
CCCAGCGTACGTTTGTGGCGTGTTGTGGGGAATCGGCTTGTGTGGCCAGCTATATGCTATCGGCGCCTTAGGTTTCGATCAGATCTTCCCCATCAGCTCG
ATCGGTCCCGCGATGGTGTCGATGCTCTGGTCTGCTGGCTATTTCAAAGAGATTCAAGGCAAGAAAAACCTGCAGACGTTGGCTCTTGGCACGGTGTTGG
TTCTCATTGGAACGGGACTAC