Description :
From Genome Similarity Track
Location :
Scaffold_7:199520- 200870
Transcript NameFunction/comments
Physo_155704hypothetical protein

Sequence
1350 bases(100 bases per row)
GATCAGAGTCGTGAACTCGTTGATCTCGGGTAGCGAGTCTTGCTGCACCATCGCCATGTTCGAGGGCGATAGTCGCCCTTGGTGGAACGAGAAAGCCTCT
GTGATCATCGGCTTTGATTGCAGCTTGGCGTACGGCACTTGACGCCAAGATCCGTCTTCCGAGTTCTCGGGAATGTGAGAGAGGCTCGCACCGCCAGTAA
CAAAGTAATACTGACTGCGGATCAGCACCGTGAGCTCCTCTTCAATCTGTAGCAGCCTCGCCTCAAGATCGATATCGTTCGCGTCCAGGCCAAAGGGACA
TTCAATCTCCATAGCGACTTCATCAGCCATGAAGAGGAATGTGCCCCACAGGAACACCCAAATCGGCGTATACAGTCCCGAGTTCGGCACGATAACGAAC
GTGTAGAGCAGCATGTAAGCGGTCAGCAGGAACTGCAGGTACTGCATGTAGTTGAACGGGATGGGAACGTTGGCGATGTTGAAGACGGTCGTGTACAGGT
TCGGCAGCTGGGCGATCTTGATCTGCAGGTTGTTCGCGTTAGGCAGCGTGAGGTGACCACGGCGAGTTGCAACCTGCACCAACCGCTTCAGCCAGAGCTC
GGTGATGGTGGCGCGCAGCTTGTGAGGCGTACGACGCACCAGAGCACGGTACGATTCCTTGTCCTTCACCTGCTTCTTGTGCTCCGAGCCACACGCGTAC
AGCTCGTCGTACTCCGCATCAGTCAACACACCCGAGTCCTTGAGTTTGTCGATACCGTCACGACCGCGACAATCGTGGAAGACGATGGCGATGTACAGGA
ACACCAGACGCCGGAGCTCCGTGAAGAAGGTGCACTTCTCAAGGACGTCACGCGGAATCGGCTGCTTCTTGTGGTGCTTCACCCCTCCCATGTGCTTGCG
CTTCTTGCCCAGCTCAATCTCCTCCTCCAACGTCCGTCCTGCGCGCTTGGCTGCGTCAGCAATGGCTTCGTCGTTGGTGTCCCCCACGTCGCGCTCCTTG
AGCTCCTCCTTGATGGTCGTGCTCACGTATGCGCATCCAGAGCTCACGATCTCTCTCGCCGCCTCGGACAGCGCCCCCATGGCCACCATACCCGCGCGCC
ATTGCGTGAAGGCCGAGTTCAACCGGAACGAGATGATGAGACCGAGAAACGTGTTGAACACGGTCAAGGAATCCGTGAACGCCGTCGAGTTGCGAGTAGC
CACCACGAATGGGTGATAGTGGTTAGTGAGGGCGACGGCCAGCGCGATCATCGCCATGAAGAACGCGCGCATCGGCGCTTGGCCATTCAGCGCCGATCCG
TGCCAACGGAACAGCACACCCCACAGTCGGGACGTGTCGTAGTAAATCAT