Description :
From Genome Similarity Track
Location :
contig_96:19951- 24858
Transcript NameFunction/comments
g12771.t1hypothetical protein
g12772.t1hypothetical protein

Sequence
4907 bases(100 bases per row)
CAAATAGCAACCCATCGCGATCCCGTTCCACCCGATCGATCAGCAAGTGCAACTTCTGGTTGTTGTGGCTCAGTTGGGCAATGCGACGACGTGCAAATGC
GACCTGATCTTGCATTTCTCGATTGCGGACAATCAGTTCCTCACAATATCGACGCCAGGGCTTTTCCGCACCATTTTCGACTTCATGCGATGCATCCCAG
GGCTGCTCTACCATACCACAATCAGCAAGTGTTTCACGTGCAACTGCAGATGCAGTTGGTGTCACGGTCGATGATTCTGCTTGTGTTTCGCCTGACGAGA
ACGATACTCGAGTTGGCGAGCACCTCGAGTCGCTATACCTGCATTCTCGAACGAGCTCATCAAAAAGCGACGGGTCCATCACTTTCTCTTCATCGGGGGC
CTGAAGCTCGAGCGCACTATTGCTGTCAAAGCTTTCGTCGTACTCGATGCCATCTTCTTCCTCGCTTGATAAATGGACAGCATATCCCCCACCCAACGCT
TCATCGTCCCAGTCAACTTGCTGTGCGACTGCGTCATGATGACCAGGCGCGTACTGGTCTCTGATATCCACACTGCCAGAAGACAAATCTAGCAGCGGCG
ACGAGTTAAACGGTGCATACTCGAGCGGGCGACCAACAACCCACTCACCCCCGTCACTGCTATCCTCATCGCTCTCACAAAACAAATTTTGTTGTTGGGA
TATGCCATTTTGCTCCATGCCAGGCCGAAATCGATTGGATAATCCACTTCCATGACGCTCATAGGCTGGAGTAGGCCCCCCGGAAAGGATCCGGACACTG
GGGCGCCTGAAAACGAACGGCGAAACGATGCCTCATCGACCATTGCAGGTGCACGCCGCTGTTCCTCCGCTGGAGACTTTACCTGATACTGTCGGAACAA
ATTGCCTCTGATTCTGCCGAAGGGCCCCCTACCCCAAGTCAACCCATCTACTGCTGCAGCGCAGCTCTTAGCCATGTCTGGGTCGTCAAATTCAAGAAAG
GCATGTCCTTTTGTACGTCCAGTGGAACTTGCCGATGGAATAACCACTTGAATAGGGTCGCCAATCATGCAAAACAAATTGCACGACAGAACTTCCATCA
GCTCTTCCGTGCGGTCCATTGACACTTTCGGCAGATTTGTCAGCACACAAACACTGTTGAAGCATGTTCCGGGGCGTGCATTTCCAAACTCAAATTGCGC
CATGTCAAAGACTGGCCACTTGAAAGGGAGAAAAGAGCGCTGCTCCAAACTATAGGTAGTACTCGCATTCAAGCTGCCGGCTATATCATGATCGTCGGAA
GATCTTCCAGGTGATACCCAACTTTGGTCGGCATCATCACTCTCATTCACGACTTCGACATGGGCGTCACACACCATTTTCACTAACGACATGAAGATGT
CAACATATGCCAGCTCGCAGTCAGAGTCGTAGTGATCAATCTCAAGAACGCCAGCCTCGAGTGCTGCACGAGTGATACTGTCGCGAAAACCAAGCCGGAT
CAAGTTTCCCAGCATCGCATTTTTGATGGCACGAGCTTTCGACGCGTTGATGGCTCGGTTCGAAGCGTCCATGAGCTCGCCTTGCAAGTCTCCAGTTGTA
TGCTCCATTTCATATCCTTCCTCCTCCGATCCCTCGCTTTCATGACCACCGTCGCTATTCGTACATCAAGCTCTCCTTGCTCTAACCTTCTGAGTTCAAC
CATACGACCAGGGGAACGCACAGGAGTGCCACGACTATGTCTCAATGGAGCTACAAACAGTTCGTCATCGGTAGCGTATCCTCCATCGTGGTTCATGTGC
TGAAGAGGCATCTCACCGACGCTCTCTGTCTCCGTGTCGTCGTCCTCTTCTGCATACTCCTCCTCGCTACCCAGGGTACTGTCTTCATTCTCTGCACACA
AATACTGCGCAGGCAACGAAGCCCTCCGTGTCTGCAGCGCAGAAGCCGAAAAGCTCCGCGATGCTTGCAGCTGCAGCGGCTGCGCAACGTCCTCGCGCGT
TCTGCCCGGTCCACAGCCGACCAAAGCTGCGTCGTGCGAGCAATCAGCGTCCTGATCTCCGCAGCTTCACTCTCGATCTCCTCTGCAAAATCGTCTCCAC
TTGCTGCGACCACTGCACTGCCTCCATTGGCTTCCGTTCACAAAAATACAAAAAATAACAGCAATTGTAAGCCACACAAGGACTCGACACAACTCTCAAC
TTTAAATCTCACCGTCTAATTGCTGGAGCTGCAGACTGGAGCGTCTGATCCTGTTCCTCGTCCTCTGTAGCATTGCTGGCGGCTCTCCGTCCCCACGGCC
GCTTCTCTCTGGCCTCAGCTGGTCCATGGGTACGGGCCAGCGACCTTTGGTCCTGCTGCTCTTCCTCCTCTTCGTCGCTCTCCGTCTTCTCCAGAGAGAA
GAACAGGCCACTAGTGGGTACAGCCGTTTGTTGTTCGTCCTGGTTTGTGGCGTCGGAGCGCGGAGTAGCGCGCGATTCGCTGTGTATTGGCATTCTGGCG
TCTGATTCAGGATTTTAACGGGGACGTATTGCAACGAATACTTCGCGTTTCGAGGCGGTTTTCGCGGTTGAAGATAGATTGGCGTGCTGCGCACACGTGG
AGAGGGTTGGTGTAGCGCTGCGGTGCGTGTGAGCTCTGCTGCAGCCGTCGCAAGAGGCCGCCGAGGTCGTCCTGAGTGCGCGCGTCCATGAAAGGAAACG
AACGCGCCCTTTTCGTCCAAGATTGCGGAACGATCTGATTTGACGGGGCTGGGTAGAATACATAACATAGGGTGATGTACACTATTTAGCGGCTACCAAC
AGATCGTCGGCGGAATTTCAACCAATGTCAACTCGAATGAGATCACAGTTTTGACCAATAGTGGCACTTCCACGACGTCGTGGATTCCGGCTCGCTGTGT
TTCCAGAAGTTCAAAGGCACAAAACAAAGCGCAAGCCGGAGGAGCTTCGGTGCGTGCTACTTTCTTCCCCCGTTCGTTCTGCACGTCTGGTTGTGTGTCT
AGCCGCTGGTTAACCCCTCGATCTCTAGTGTCTGCGTGTGTGTGTGAAACAGCGGCGTCCAGATCTTCCCACAAGGAGATTTAACGTCGGATATAGTGGA
AAAGGTACGAAAACGAGAAAAAAACACGGCTAAAAGGCGCTCAGAGCGGCGTTTAAACAGCTTTCTAGCAGCTATACAAGCTGCAGCAGATCGCCCTGCA
CCTTGCAGCGTGGTCGCGTGGGGCTGTATGAGCTAAATGATGACCTCGTCACTGATTTTATGACATTTGTGTCGGTTTTACTCGGTTTTAGCAGTTTCTA
CAGGGTAAACAAGAACAAGATGGAGGCTATCGGCCAGAAGCTGCTGGATTTCTCGCAGCCCTTCGATGTGGCGGCGCTGGACCAGGTGGTGCTGTGCATG
AACGACCCCAAGAGCCCCACCAGCGGGTGGCCAACCAGATCATGGTGGCGCTGCAGGAGCACCAGGACTCGTGGACGCGCGCCTCTGACATCCTGGAGCA
GTCCAGTAGCATCCAGACCAAGTTCTTCGGTCTGCAGGTGCGGTGATAATTGTTGCAGTTGTGACACAATTTGGAGACTCTGACATGCATTTGATGGGCA
TCAGATCTTGGAGGACGCGATCCGCTACCGCTGGAAGATCTTGCCCAAGGACCAGCGCGAGGGAATCAAGAGCTACATTGTTGGAAAGCTGCTATCGGTG
CGTTGGCGTTGGTTTATTTTTTATGGCGATTGATAGAGGTGCTGATTCGGGTGGGGTGTATTGGTTGTGTGCAGCTATCGTCCGATGAGTCGACGCTGCA
CGGTCAGCGCATGTTTGTGAACAAGATGGACCTCGTGCTGGTGCAGGTGTTGAAGCACGAGTGGCCGCAGAACTGGCCGTCGTTCATCACGGACATCGTC
AACTCAAGCAAAACGTCGGAGATCTTGTGCGAAAACAATATGACGATTCTGAAGCTGCTGAGTGAGGAGGTGTTCGACTTCTCGAAGGACCAGCTGACGG
AACAGAAGACCAAATCGCTCAAGGAAAGCCTCAACCACGAATTCACGCAGATCTTTCAGGTACGATTGAGAGCACGGAGAAAGCGCGGTTCGTGTGGCCA
CAATCGTCTTCGATCTCAACAACGCTAACGTTATGTTTTTATTCTTGCTGTCGATCCTGCTACCGTAGCTGTGCGAATTTGTGCTGAACAAGTCGACACA
CGTTCCGCTGCTTCAGATTACGCTGCAGACACTGCTTCGTTTCCTGAGTTGGATCCCGCTTGGTTTCATCTTTGAGACGGACCTCATCAAAATCCTTGTC
ACAAAATTCCTGGCGACGGGCGTGTTCCGCAACGAAACCATCAGCTGCTTGAGTGAGATCGCGCAGCTGCGCGACGTCCCTGAGCAGTACAACAACGTGT
ACGTACAGCTGTACATGGGCGTGCTTAACGAGGTTGGAAAGATCCTGCCGCCTGGAAATTCGTTCACTCCGTTCTGGGAGCAGGACGAGGTGTTTGTTCA
GCGTTTGAGTATTTTCTTCACGAGTTTCTTCCGTTACCACATCCAAGTTATTGAGCGCCCGATTGCCGCTCCGGGTGATGAAGCCCACCAGGCGCTGCTG
GCGGGATTCACGTACCTTGTGTGCATTGCCGAGGTGGACGACGACAGCATTTTCAAGATCTGCTTGGACTACTGGCATTTCTTTACGCGTGATCTGTACA
CGGTGGACCAGAACCAAATGAACCCGCTTGCAGGATTCCAGAACCAAGCTCGTAGTCGCCGTGAGCTTGTATCGCCCGTGATGAACCGCGTGCGTCACGT
AATGATCTCCAAGATGGTAAAGCCGTCGGAAGTGCTGATTGTGGAGGATGAGAATGGCGAGATCGTACGCGAGACGACCAAGGACACGGAGGCGCTGTCG
CAGTACA