Description :
From Genome Similarity Track
Location :
scaffold_15:19951- 22029
Transcript NameFunction/comments
g892.t1 hypothetical protein PHYSODRAFT_488611
g893.t1 conserved hypothetical protein

Sequence
2078 bases(100 bases per row)
AGAAGAAGCCCGTTGTAGTGTTCGTGCCCTCAGCCAAGCAGGCACAGCTGAGCGCAATCGACCTGATCACTTTTGCCTTGGCTGAGAACGACGCGCACAA
GTTTGTCGTTCACTCCGCTAAGGACAAGGTGGAGTTGCCCGTGGAAGATGCTGCGTTGCTGCACACCATGGAGAACGGCGTTGGCTACTGCACAGACATA
TTGTCCTCTCGGAATCGTGAATACGTGCTGAATCGTTTTTTGACGGGCAAGATTCAGGTGTTGATTGTTCCGCAGTCGATGGCTTGGGAGCTGCGAAGTG
CGCAGAGTAGTGCATTCATGGTGGTGATTATGGGCGCGCAGTTCTACGATGGCCGCGAGCACCGTTACGTTGACTATCAACTTGCTGATTTGTTCCAGAT
GACCAAGTTCGCCAATCACGCTGCTTCTTCTGCTGTTAAATGCGTTCTGTTCTGTCACGCATCCAAGAAGAAGTTCTACGCCAAGTTCCTGTACGATCCG
CTACCTGTGGAATCGCAGCTTGAGCATTTCCTGAGCGATCACATTAATGCTGAGATCGTTACGAAGACCATTGAGAGCAAGCAGGATGCAGTGGATTATC
TCACGTGGACATTCATGTACCGACGCTTCATGAAGAACCCGAACTATTACAACTTGCAGGGCGCTACCAACGTGCACTTGTCAGATCACTTGTCGGAGCT
TGTGGAGACCACTGTGAATGCACTGGAGGAGTCGCGCTGTATTCAAGTTGTCGAAGAGGAAGAGGATGAAGGAGAGGAGCGCCTTGTGCCACTGAACCTC
GGCATGATCGCGGCGTATTACTACATTAAGTACACCACGATCGAGCTGTTCGCATGCAGTCTGAAGGCGGACTCAAAGGTTCGCGCGCTTCTGACGATTC
TGTCATCCGCTACGGAGTTCAGTGACTTGCCTAGTCGGTATGGCGAGGACAAGAAGCTGGAGAGTCTTGCGAAGCACCTGAAATTCCCGGTAGCTGCTGG
GGGAGACTACGGACAAGCGCACGTGAAGACAAACGTTCTGCTGCAAGTCCACTTTAGCAAGCAGCATGACCATCTGAGCCCTGCGATGCGGCAGGATCTT
GACTTCATTCTACGTCACGCTGTGCGTCTTGTGCATGCCATGGCAGACGTGATCAGCTCGAACGGGTGGCTTAAGCCTGCTCTGGCAGCTATGGACTTGG
CGCAAATGATCGTGCAGGCCCAGTGGAGCAGTGACTCACCGTTGCTGCAGATCCCGTTCTTCACGAAGGACATGCTCAAGAAGCTGGGTGAGATGGATCT
GGAAGAGGACGTTGAAACTCCTGTGGATATCTTGAGTATGGAAGACGATGCTCGTGGCGAGTTGCTGCCTCTGGATACGCAGAAGATGTCGGCAGTCGCG
AAGTTCTGTAATGCTTACCCAGACGTGACTGTCCAAACGAAGATTGAGCAGGACGGCAAGAATTTGCCACAGGGATCTGCTGTGAGCGTGAAGGTGCAGT
TAGAGCGTGAAGGTGCCGATGAAGATGACGAAGAGGAGGAGGATGACGAGGCCAAGGAGCTGGGTCTGGTGAACGCGTGCCATTACCCTGTCAAAAAGGC
TGAGAACTGGTGGGTGGTGTTAGGCGATTCCAAGAAGAACACGCTGCTGAGCATCAAGCGTGTGCCTTTCGCGAGTGCTCGTGCGAATGTGGCGCTGCAG
TTCGCTGCTCCGGATGAGATTGGAGCGCACACGTTCCAGCTCTATGTGATCTGCGACGGCTACGCCGGTTGTGACCTAGAGAACGAGGTCAAGATCACCG
TTGTTGAGGGCGAAGACACCGACGATGAGGAAGAGGAATAGGGGGTTCATACTGGAATAAAGGCAACAACTTAAACATCGGCGTATCATTCATTTTATAC
CTGCTACTTCTTAGATATCTAGGGTGCACACGACTCGGGGTCCTCTTCTTCAGTCTCGCTTGCCGACTTGGGCCTGGGAAGGTGTGGAGCACGAAAACTA
CGAGTCTTCAGTTTACGTGCAGCCTCAACCGATGCAGCATTGAGGAGACCGGCGGCTTTGAAGACACCAGCACGAAGC