Description :
From Genome Similarity Track
Location :
Scaffold_685:1995- 5299
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_685-abinit-gene-0.22Transducin family protein

Sequence
3304 bases(100 bases per row)
GAAACTGCACTGTCTGGAGGCCCTGGCCCACGACGGCGACGCTGTCTGCACTGCCGCTTGGCGTGGTCATGACGCTCAAGTCGGCAATGTCGGCACACTC
GGTGAACGCCGCGCACTGCCACGCCAGTTTGGCGTCGTCTTCGCATGCCCACTGGTTCACGCGCTGGTCGTAGCCGGCGCAATAGATGAAGTGGCCATCG
CGGGATGTCGTCACGGCCTTGAGCGCCGAGCCGCTGGCGTTGCGCACGTGGGACTCATGGACGAGTTCTAGCGAGTCGGCGCTAAGTTCGTGCACGCGGA
GATTCTGATCGTCGCCTCCACTGATGATGCGAAAGCGTCGTGATGCTGCGTCGCCGGGAACACGGGAGATGCAGAGGCAGTTGGTGCCCATGTCGTGCGC
AAGGTACTTGTACACGGGCTGCAGCTGCTGGACGCTACTTGCAAGCGCCGATCGCTCCATCGACTCTTCAGCAGCAAGGCTGAGTACGTGGGTCAAATCC
CACACATTGACCATGCCGTCCGTGGATCCCACTGCGAGCAGCGCACGTCCCGAGATCTGCACGCCATCACAGCTCAGGATCGGCTTCTTGGATGACGAGC
ACTGTCCTAGCTCCTGAAGCAACGTTGGTGAACTGATACTCTCGCCCAGATCCAGTCGCAAGATTTGGATCGCACCCTCGGAGTTCGTGGCGACAATGAC
GTGGCAACGGTCGCTGGTTGAAAACGACGTGAGCCCGAGAATGCGGTGGTCTTGGTCGGCGTCCGACACTTCCTGGCCACACAGAAACTCCATCACGTCG
AGATCGTCGCGTACGCGCCAGGCGTTCAGCCGCTGCTTGCCGCCACCGGAAAGTACGATGTGGGTTTTTTGAGAGGCCAAGTAGAACGCATGGAGTGCAC
GGATCGTCGTCGTGTGGGCGACCCCCGTGGAGAGACATTTCCAGCGATTCACCATAGGGATCCCAGCGACCGTCTCAACGGGCAGATATCTGTGGAGCTT
GAGAGCATTGTCCTCGCCCGCTGTGACGAGCCGATCCGTGCCAATCGCCTGCACACAGGTCGTCGTACGACCGTGGTAATAATGGTGCAGGGAGGCACTG
GCAATAACGACGACCGACTGGATCGTACTAGATGTAGAGTGCACTTGCACGAGCAGCTCGGACTGTTTCGTGACGGGTGTGAACACGAACGTGTGCGCCG
GAGTGGACGAGTCCGATGCCAGTAGACGGAGCGCGTGTGGACGCCGCCAGCCGCCGCACTCCACGTTGAACAGTCGGTACTGCGCCGTAAGATTATAGAG
TACGGCAAACGTCGCGTGGAAGCCAAAGACCATGAGGTCGCGCTGGTCGTTGAGCCACAATTGCTTGATCGTAGTGATGCCCTTGATGGACTCGCGACCG
ACGAACCGAAGCGTGACGACGCCTGTGTCCGTCGAGTCGACAAGGTAGGAGCAGATGTATCCATCGTGTCCACCCGAGTACACCAACCGATTGTCATGCA
ACAGCGTCGCGATCATATCACGCCCGTGGATGCCACGCATCGCGAAGCTGGGATCCGCGGGTGCTTCCACTGATGTGTCCCCCACCAATGACCGAGAAAA
CCCGAAGAGATTGGCGCGGGCATCACCGCAAATCATGTTTCTCGTGGCGGCGATATCGACGATAGCAATGCTTGAGGTGGCGCACTTGGCGGGACCACGA
TAGTCGCCCATGAGCGTCGGCAGCTCTTGGCCCTTGTCGTCGGGTATACGCCACTCGCGGACGCCGCCATCGGCGCCACACGTGAAGAGCGTCCCGTAGG
CGGCGCGGTTCCACCAGATCTTCATGATGCGGGACGCGTGGGCCTTCCAGACAGCCCGCACAGCGAGGGTCGCAATGTCGAGGACCACAACCGATCCGCT
GGCGTCGCCGATCAGTAGAACCTGCTCGTCGTCGTCCATCGCAAAGCTCGACACGTTGGGGACTGAGTCGCTGTGCGTCTTGTCGGCGACCGTGAAGAGC
AACCGCGTTCTCGTAGTCGGTGCCTCCAAGTCCAGTTCGTAGATACGTCCGTCTTCCACAGCGATAAACCCCCGAGCACTCTGGCTGCCGCGCGTGATCA
CAATGTCGCGGATGCTTAGACTCGCTGTCTTCTTCTTCGTCGTCACGACCTGCTCAGGCTCGGGCACGAGACGCACCACTTCGCTGTCAGCACCAGCCGA
CGCGATCGACGACTTCATTTGCTGCGGCAGATCCCACAGCTTAACGGCACCATCGCCCCCACCAGTCGCGAGCATTTGGGCGGACGGATGCACGGCGACG
CGCCACACATGCTTGCCCGCGTGGCCCTGCAGCGTCGCCACGCAAGTGCCGTCGCTCACACGCCACACCTTGCACATGCCGTCTTCGCTCGTCGTGACAA
GATTGGAACCACAAAAGCGAACGTCCCAGAGTCGTGCCGTGTGGCCCCACGCGCGAAAGCGAGAGGTCCACGGACGCGTAAGCCTCTCGGAGCTGGAGAA
GGTCTCAGTCACGTCGCTGTGGTTTGTCCAGAGTTGGACCGTACGATCATCCGACACGGACACGAGCATACGCGCGTCGTGGGACCACTCAAGTTTGAAG
ATGACGCCGTCGTGGCCGTGGAGCCGCTGCTTCGGGTCGGCGCGATCGAGCGTGCCGTCAATGTCCCACAGCAGCACCTGCTGGAACACCGTGCCGGACG
CGACCAGGAGGTCTTCGACAGATCGTCCGTAGAAAGAGAGCGAGTAGAGAATGCAGCGCTCCGAGCAGATCACGGTGCGCAGCACCTGGTTAGAGTGGGC
GTCCCACAACTGGATGAAATTGTGGGCCAAGCCAATGGCAATCGTCGGGAAGGTGTCGGCGGAAGCGTGCTCGCTCAAAATCTGGACGTCAAAGATCCAG
TCCGAGCACGCTTTGGCTGTGCCCACGCGCACGAGATCAGTGGGTTGGGCTAATGCAGCAGCGGTCGACTCGGGGAGATCCTGGACGCACTGGAGCCGCT
TCTGGCCGAAAAACACGGTCCAATTCTGACCGTTTCCACGAGAGACTATACGTTCACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGGTATG
GTGGGAATGATAAACGGCAAAACCAGCACGGTAATACCATAATCGAGTCCGTGGAGTGTGCCGCGAGAGAACACTTGGTAGCTGGTCGCGAGCCTTCCGG
TAGCCGTCTCGTACGCGTACAGTGACGCTCCGACACCCACGAAAAGCAGCGATCCGTCGCTTGAGAAGTGCAGCAGCGTCACGGCGCCTACGTATTCCTG
CTTC