Description :
From Genome Similarity Track
Location :
contig_96:19941- 24848
Transcript NameFunction/comments
g13291.t1hypothetical protein
g13292.t1hypothetical protein

Sequence
4907 bases(100 bases per row)
GCAAGTCGTTCTCAAATAGCAACCCATCGCGATCCCGTTCCACCCGATCGATCAGCAAGTGCAACTTCTGGTTGTTGTGGCTCAGTTGGGCAATGCGGCG
ACGTGCAAATGCGACTTGATCTTGCATTTCTCGATTGCGGACAATCAGTTCCTCACAATATCGACGCCAGGGCTTTTCCGCACCATTTTCGACTTCATGC
GATGCATCCCAGGGCTGCTCTACCATACCACAATCAGCTAGTGTTTCACGTGCAACTGCAGATGCAGTTGGTGCCACGGTCGATGATTCTGCTTGTGTTT
CGCCTGACGAGAACGATACTCGAGTTGGCGAGCACCTCGAGTCGCTATACCTGCATTCTCGAACGAGCTCATCAAAAAGCGACGGGTCCATCACTTTCTC
TTCATCGGGGGCCTGAAGCTCGAGCGCACTATTGCTGTCAAAGCTTTCGTCGTACTCGATGCCATCTTCTTCCTCGCTTGATAAATGGACAGCATATCCT
CTACCCAACGCTTCATCGTCCCAGTCAACTTGCTGTGCGACTCCGTCATGATGACCAGGCGCGTACTGCTCTCTGATATCCACACTGCCAGAAGACAAAT
CTAGCAGCGGCGACGAGTTAAACGGTGCATACTCGAGCGGGCGACCAACAACCCACTCACCCCCGTCACTGCTATCCTCATCGCTCTCACAAAACAAATT
TTGTTGTTGGGATATGCCATTTTGCTCCATGCCAGGCCGAAATCGATTGGATAATCCACTTCCATGACGCTCATAGGCTGGAGTAGGCCCCCCGGAAAGG
ATCCGGACACTGGGGCGCCTGAAAACGAACGGCGAAACGATGCCTCATCGACCATTGCAGGTGCACGCCGCTGTTCCTCCGCTGGAGACTTTACCTGATA
CTGCCGGAACAAATTGCCTCTGATTCTGCCGAAAGGCCCCCTACCCCAAGTCAACCCATCTACTGCTGCAGCGCAGCTCTTAGCCATGTCTGGTTCGTCA
AATTCAAGAAAGGCATGTCCTTTTGTACGTCCAGTGGAACTTGCCGATGGAATAACCACTTGAATAGGGTCGCCAATCATGCAAAACAAATTGCAAGACA
GAACTTCCATCAGCTCTTCCGTGCGGTCCATTGACACTTTCGGCAGATTTGTCAGCACACAAACACTGTTGAAGCATGTTCCGGGGCGTGCATTTCCAAA
CTCAAATTGCGCCATGTCAAAGACTGGCCACTTGAAAGGGAGAAAAGAGCGCTGCTCCAAACTATAGGTAGTACTCGCATTCAAGCTGCCGGCTATATCA
TGATCGTCGGAAGGTCTTCCTGGTGATACCCAACTTTGGTCGGCATCATCACTCTCATTCACGACTTCGACATGGGCGTCACACACCATTTTCACTAACG
ACATGAAGATGTCAACATATGCCAGCTCGCAGTCAGAGTCGTAGTGATCAATCTCAAGAACGCCAGCCTCGAGTGCTGCACGAGTGATACTGTCGCGAAA
ACCAAGCCGGATCAAGTTTCCCAGCATCGCATTTTTGATGGCACGAGCTTTCGACGCGTTGATGGCTCGGTTCGAAGCGTCCATGAGCTCGCCTTGCAAG
TCTCCAGTTGTATGCTCCATTTCATATCCTTCCTCCTCCGATCCCTCGTTTTCATGACCACCGTCGCTATTCGTACATCAAGCTCTCCTTGCTCTAACCT
TCTGAGTTCAACCATACGACCAGGGGAACGCACAGGAATGCCACGACTATGTCTCAATGGAGCTACAAACAGTTCGTCATCGGTAGCGTATCCTCCATCG
TGGTTCATGTGCTGAAGAGGCATCTCGCCGACGCTCTCTGTCTCCGTGTCGTCGTCCTCTTCTGCATACTCCTCCTCGCTACCCAGGGTACTGTCCTCAT
TCTCTGCACACAAATACTGCGCAGGCAACGAAGCCCTCCGCGTCTGCAACGCAGAAGCCGAAAAGCTCCGCGATGCTTGCAGCTGCAGCGGCTGCGCAAC
GTCCTCGCGCGTTCTGCCCGGTCCACAGCCGACCAAAGCTGCGTCGTGCGAGCAATCAGCGTCCTGATCTCCGCAGCTTCACTCTCGATCTCCTCTGCAA
AATCGTCTCCACTTGCAGCGACCACTGCACTGCCTCCATTGGCTTCCGTTCACAAAAGTACAAAAAGTAACAGCAATTGTAAGCCACACAAGGACTCGAC
ACAACTCTCAACTTTAAATCTCACCGTCTAATTGCTGGAGCTGCAGACTGGAGCGTCTGATCCTGTTCCTCGTCCTCTGTAGCATTGCTGGCGGCTCTCC
GTCCCCACGGCCGCTTCTCTCTGGCCTCAGCTGGTCCATGGGTACGGGCCGGCGACCTTTGGTCCTGCTGCTCTTCCTCCTCTTCGTCGCTCTCCGTCTT
CTCCAGAGAGAAGAACAGGCCACTAGTGGGTACAGCCGTTTGTTGTTCGTCCTGGTTTGTGGCGTCGGAGCGCGGAGCAGCGCGCGATTCGCTGTGTATT
GGCATTCTGGCGTCTGATTCAGGACTTTAACGGGGACGTATTGCAACGAATACTTCGCGTTTCGAGGCGGTTTTCGCGGTTGAAGATAGATTGGCGTGCT
GCGCACACGTGGAGAGGGTTGGTGTAGCGCTGCGGTGCGTGTGAGCTCTGCTGCAGCCGTCGCAAGAGGCCGCCGAGGTCGTCCTGAGTGCGCGCGTCCA
TGAAAGGAAACGAACGCGCCCTTTTCGTCCAAGATTGCGGAACGATCTGATTTGACGGGGCTGGGTAGAATACATAACATAGGGTGATGTACACTATTTA
GCGGCTACCAACAGATCGTCGGCTGAATTTCAACCAATGTCAACTCGAATGAGATCGCAGTTTTGACCAATAGTGGCACTTCCACGACGTCGTGGATTCC
GGCTCGCTGTGTTTCCAGAAGTTCAAAGGCACAAAACAAAGCGCAAGCCGGAGGAGCTTCGGTGCGTGCTACTTTCTTCCCCCGTTCGCTCTGCACGTCT
GTTTGTGTGTCTAGCCGCTGGTTAACCCCTCGATCTCTAGTGTCTGCGTGTGTGTGTGAAACAGCGGCGTCCAGATCTTCCCACAAGGAGATTTAACGTC
GGATATAGTGGAAAAGGTGCGAAAACGAGAAAAAAACACGGCTAAAAGGCGCTCAGAGCGGCGTTTAAACAGCTTTCTAGCAGCTATACAAGCTGCAGCA
GCTCGCCCTGCATCATGCAGCGTGGTCGCGTGGCGCTGTATGACCTAAATGATGACCTCGTCACTGATTTTATGACATTTGTGTCGGTTTTACTCGGTTT
TAGCAGTTTCTACAGGGTAAACAAGAACAAGATGGAGGCTATCGGCCAGAAGCTGCTGGATTTCTCGCAGCCCTTCGATGTGGCGGCGCTGGACCAGGTG
GTGCTATGCATGAACGACCCCAAGAGCCCCACCAGCGGGTGGCCAACCAGATCATGGTGGCGCTGCAGGAACACCAGGACTCGTGGACGCGCGCCTCTGA
CATCCTGGAGCAGTCCAGTAGCATCCAGACCAAGTTCTTCGGTCTGCAGGTGCGGTGATAATTGTTGCAGTTGTGACACAATTTGGAGACTCTGACATGC
ATTTGATGGGCATCAGATCTTGGAGGACGCGATCCGCTACCGCTGGAAGATCTTGCCCAAGGACCAGCGCGAGGGAATCAAGAGCTACATTGTTGGAAAG
CTGCTATCGGTGCGTTGGCGTTGGTTTATTTTTTATGGCGATTGATAGAGGTGCTGATTCGGGTGGGGTGTATTGGTTGTGTGCAGCTATCGTCCGATGA
GTCGACGCTGCACGGTCAGCGCATGTTTGTGAACAAGATGGACCTCGTGCTGGTGCAGGTGCTGAAGCACGAGTGGCCGCAGAACTGGCCGTCGTTCATC
ACGGACATCGTCAACTCGAGCAAAACGTCGGAGATCTTGTGCGAAAACAATATGACGATTCTGAAGCTGCTGAGTGAGGAGGTGTTCGACTTCTCGAAGG
ACCAGCTGACGGAACAGAAGACCAAGTCGCTCAAGGAAAGCCTCAACCACGAATTCACGCAGATCTTTCAGGTACGATTGAACGCACGGAGAAAGCGCGG
TTCGTGTGGCCACAATCGTCTTCGATCTCAACAACGCTAACGTTATGTTTTTATTCTTGCTGTCGATCCTGCTACCGTAGCTGTGCGAATTTGTGCTGAA
CAAGTCGACACACGTTCCGCTGCTTCAGATTACGCTGCAGACACTGCTTCGTTTCCTGAGTTGGATCCCGCTCGGTTTCATCTTTGAGACGGACCTCATC
AAAATCCTTGTCACAAAATTCCTGGCGACGGGCGTGTTCCGCAACGAAACCATCAGCTGCTTGAGTGAGATCGCGCAGCTGCGCGACGTCCCTGAGCAGT
ACAACAACGTGTACGTACAGCTGTACATGGGCGTGCTTAACGAGGTTGGAAAGATCCTGCCGCCTGGAAACTCGTTCACTCCGTTCTGGGAGCAGGACGA
GGTGTTTGTTCAGCGTTTGAGTATTTTCTTCACGAGTTTCTTCCGTTACCACATCCAAGTTATTGAGCGCCCGATTGCCGCTCCGGGTGATGAAGCCCAC
CAGGCGCTGCTGGCGGGATTCACGTACCTTGTGTGCATTGCCGAGGTGGACGACGACAGCATTTTCAAGATCTGCTTGGACTACTGGCATTTCTTTACGC
GTGATCTGTACACGGTGGACCAGAACCAAATGAACCCGCTTGCAGGATTCCAGAACCAAGCTCGTAGTCGCCGTGAGCTTGTATCGCCCGTGATGAACCG
CGTGCGTCACGTAATGATCTCCAAGATGGTAAAGCCGTCAGAAGTGCTGATTGTGGAGGATGAGAATGGCGAGATCGTACGCGAGACGACCAAGGACACG
GAGGCGC