Description :
From Genome Similarity Track
Location :
Scaffold_17:199409- 205143
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007128Similar to pnp: Polyribonucleotide nucleotidyltransferase (Streptococcus thermophilus (strain CNRZ 1066))
Pytul_DAOMBR144PYU1_G007127Similar to rsp-6: Probable splicing factor%2C arginine/serine-rich 6 (Caenorhabditis elegans)
Pytul_DAOMBR144PYU1_G007126Similar to SF2: Pre-mRNA-splicing factor SF2 (Arabidopsis thaliana)
Pytul_DAOMBR144PYU1_G007125Similar to RpL38: 60S ribosomal protein L38 (Spodoptera frugiperda)

Sequence
5734 bases(100 bases per row)
GACATCTTGCCCGAGAATCCTTCCTGGATGCACTCGAACTCGAGCTCTTGACCGACCGAGACAACGTCGTGAATGTTTTCCACGCGTTGGTGTGCCAACT
CGGTGATGTGCACAAATCCACGGTTTTTCGATGGCGAAGTCGACTCCAAGATCGCGCCAAAGTCCATCACTTCATTCACACGCATCGTGTACTTGGCTCC
TCGCTTGAAGAACGCGTCTTTTTCCTGCGCGGTTTGTCCAAGAATGGCCTGTTTCGCGTTCTCGGTATTGTCTGGCGAACCCACGACGCGGAGCGCACCG
GTTTTGCGATCAATGCTTACCGTGACTTCGAACGTGCGCTCGAGTTCACGAATGTTAGAGCCTCCCGCACCGATCAACGCGCCAATCGAGCCCACTGGGA
TGGAAAACTCAAGACCGACGTTGATCTCACCCGTCGGCGAGTTCTTGAGCTCCTTGCGCGGCTCCGAGATCGTGGCGTTCATCTTGCGGAGAATGTTCGT
GCGCGCCTTCTTGGCGTACTGGATACCCTTGCACAAGATGTCCAATGGGATACCTGGGAGCTTCACATCGAGTTGGATGGCCGTGATACCAGTGTCCGTA
CCAGCGATCTTGAAATCCATGTCACCGTAGTGGTCTTCCGTGCCGAGGATATCGGTGATCAGGCGGTAGTTCTTGATCTCCTTCTCACCGTCAAACGGAT
CGCCCTCGGTGATCAAACCGATCGAAATGCCCGCGACTGGGGCCTTGATGGGCACGCCAGCGTCCATCAACGCAAGCGACACACCGCACACAGTCGCCAT
CGATGACGAACCATCAGAGCCCATGGTCTCCGACGTCATACGCACAGTGTACGGGAACTGGTCGATCGACGGGATCACTGGCACGAGCGCTTTCTCCGCA
AGTGCACCGTGGCCAATCATGCGGCGGTTGACACCACCAACGCGACCCGTTTCATTTACACAGTATGGTGGGAACTCGTAGTGCAGCATCGCGTGCTTCA
GTGGGATGTCCTTGGTTGGGTCCATCTGTGCCGATCGCACCTTGAGACCGCGGTCCAGAGGTCCGAGCGTCACAGAGCAGAGCGCTTGCGTGTCGCCACG
AGTAAACACGGACGAGCCGTGGGCCATCGGCAACACATCGGTCTCCACCTTCAGAGGACGGATCGTGAACGGCGAGCGGCCATCGTAGCGCGCGTTTTTG
TCGCCCGAGAGGATCTGTTCACGCAAGGCTTGCTGGAACACATCATGTGCCGCCATCTGGAACTGAGCATCATCGAAATCGCGGCCCTGGAAGTGCTCGC
GAAGCGTCGAGATGATCTTGCCGTACACGTGCTTCTCGCCCTCTTGGCGCTCGACCTTGGTGAGCTTTGGGCTGCTCAGCATGAGGTTGGCCTCTTCGAG
ACCAGCTTCCTTGGCCTTTTCCATCACTTCGTCGTCGACCACAAGTCTCATGTACGAGCGCTTCGGCTTGCCGAACTGCTTGACAAGTTCCTTCTGCGTC
TCAATAATCGGAACCACAGCATCGTGCGCAAACTTGAGCGCTTCAGCCATGCGGTCTTCGGTGATCTCTTCACCCGAAGCCTCAATCATGAGCGTACGCG
TCTCGTTCGCAGCATAGAGAATGTCGAGCGTCGCAATGTCACGCTGCTGCTTGGTTGGGTTCACCACGAGTTGGCCATCGATCTCGACGACACGCACGGC
GCCGACAGGTCCGTTCCACGGAATGTCCGAGACCGCAAGCGCTGCAGACGTGCTGTTGATCGCGACGATCAGTGGGTCGTTGTTCGTATCCAGCGATTGC
ACCGTCGCGATCACTTGCGTGTCGTCGTAGTAGTCGCGGGGGAAAAGTGGACGGATCACGCGGTCGACCACGCGGGATTGCAAGATCTCTTCGTCGGTGC
CGCTGAACTCCGTGCGCTTGGCAGTGTCTGGGATCAAGCCCGTCGCGTAGTACTTGACGCGGTAGTCGACCATCAACGGGAGGAAATCGCGGCCGCGCTT
GCCTCCGACAGAGCTCACAGCTGTCGTGAGCACCATGGTCTTGCCGCATGTGGCCATCACCGAACCGTCCGCGAGGCGCGCGTACTTGCCCACAGAGAAG
CTCGTCTCGTCCAAGCTCCCGACCAGTTTCTCTTGTGAAACCGCATCAGCAGCTTCAGAGGCAGCCGCGTCTGCAGATGCAGTGGCAGCAGCAGTATTGG
CATTCGATGTGCCATCATTTTCCTTGGCAGCCGCCGCGACTGGCGCCTTCTTATCGTCAGCAGCAGCTTCGTCCTTCTTTTTGAAGAGCAGGTCGCGCAA
TCCGAAGAATGCTCGCGCCTGCTGCCGCGCGAGCGGGTGCAGTCGGGCAGCAGCGCCATTGCCATTGCTGGCCACGGCGTGACGCAGCAGGCGGCTCGAT
GGAGCGGCCGAGTACTGCAGACGCGCGGGGATTCGGCGGCCGGCGCTCAACATCGTCGTCGATGGCGCGAGGCTTAAATTGCGTTGGTCCTTTTGGACTT
TGGTTGGATGGCCACACAAACAGACCCATACAACCGATTCTGCTTTGAATAAAAGACTCTGGGGCCAAACCTCCATGAATACTGCTTTTAATTACGGGAA
GATGCCTTGCTCAGTTTGTCATACTAGCTCGTCGTGCACTTCTGCGAACCTTTGACAATATTTCGATCTGTCGGAAGCATGTAGAGGCTTCGCACACACC
TCTTGAACCATTACGAAAATGCTCAGTTCACTCGTGCATTCCGCGCCCCAGTCTGTCGCCTCCGAGATGCTTTTCCATCACATGAACGCATGCAAGTTTT
TATTTACGGGAGTGTCAACTCCATAAACAAAGCTGTTACGAGACAGAACAGAGCTCGGTTCGTAACTGAGCCGCGAACGCCTTGAAACCAATCAAAGAAC
CATCTCGCAACGGTTTTTGGACTATTCGACCAGTACAACTGCCAGCAACCAGAAGAAGGTAGAAACGCGTCGTCGTACTGGTCTGGTAGCCAACCGCTTC
TGTGTGTTTCCTGGCGCGCTTTCGCTTTCCCCCCCGCCCACCGCCGCGTTCATCCCCATACAAACTCGCTGCTATTTCCAACAGAAGCACGCCTCCAAGG
CCACCAACAGAAGAGACCAAGCAAGAGCAAGAATGGGCACCCGTGTGTACGTCGGTGGACTGCCTCGTGACGCCACGTCGCGTGAGATCCAGGACGGCTT
CAGCCGCTACGGCCACGTGTCCAACATCTGGGTCGCGCGCAACCCGCCGGGCTTCGCGTTTGTGGTGAGTGCTGCTTCTCCTGACTCGTCTCGCCATGGG
CGTCCGAGTGCTGCACATAGCGGTGTGTGGTGCGCACATGCGCGTGCGGGTGGGATGCGTACATCGTCTTCGGTCGTCTTCTTCTCCTCGTTGTTGTTGT
TGTTCTTCGCTCGAGCATGATGGCGCGGTCGGCTGGATCTTCTCTTCGCCCCTTCTGCATCGGTAAAAAGAACGAGCGACCGTCGGTGGTGATTATCTCG
ATCTCTTCATCGTCGGAAACCGGCATGCGTAGTAGTTTTAGGTAGTTGATGCGTCCGCGAGTCGTCGGGGGTCTACGAGTCGGTCTACGATTCTTGTGTG
TGAGCGTTCGTACGAGCTTCGTATCCGCGTCGCCGTCTCGATTCATCGTTCGCCGTCGACTGGTTTCGTCATTAGAGAGTTAGAGAAAGACCCCATCGTC
ATCGCCCGCCTTCCTCCACGACGACGTGTTTCCTCGTTGATGTGCCATCATGCTTCGCCTGCCTCCACCCACTACCACCACTCCAGCATGTCGCCGCACC
CGCTGCCGCCCTCGCTCGCTATTGCTCTCCACGTGTGCACCAACCAACCAATGCCCGCCTTCTCTTCGTCTGCCCTCTGCTTCTCGTCGTACTCTAGGAT
TTCGAAGACCCACGTGACGCCGATGATGCTATTCGCTCGATGGACGGACGCGATTTCCTCGGTGGACGGTAAGAAAGCGACAAAAAAATGTGCATGCATA
TCGCTCCTGGAACTGACATTTGTTATTTTATGTGTGTTGCAGCATTCGTGTGGAACTAGCCCGTGGTGGCTCTCGCCGTGATGATCGTGGAGGCCGTGAT
GGTGGTCGTGATCGTGACGGTGGCCGTGGCGGCGATCGCTTCGAACGCAATGGTACGCTTTGCACATTCATTAGTAAAAAGATGCGTAGATAGTGGTTGT
TGACTGACTTTGTGATCGTTGTATGCGTAGCTCGCACTCCTCCAACGCGCACGGAATTCCGTGTGCGTGTGTCGGACCTTCCTCGTGGAACGGACTGGCG
CAACGTGAAGGACTTCCTCCGTTCGGGTGGTGAAGTGACCTACTGCAACATCGAGTCTGACGGCACTGCGTACGTAGACCACATTGTGATCCTTATGCCT
GAATCAGTGTGTGAGCGAAGTCAACTAACTGATTTTTTATTTCTGCATCTTCTCTTGCTGATCAGTCTTGCTGAATTCCAGTCCAAGGACGACATGGAGA
ACGCCATCAAGAAGTTGGATGACACGGAGTTCCGTGGCAACTACGTCCGCATCACCGCCGAAGGCTCGGACCGTCGCTCGCGTTCCCGATCGCCACCTCG
TGACCGCTCTCCTCGTCGCTCGCGCTCGCGCTCCCCTGCTCAGCGCAAGGACTCTCCTCGTCGCTCGCGCTCGCGCTCGGTGTCTCCAGCGGCCGCCCAC
TCGCCACCTCCACGCAAGAACTCCGTCTAAGTGGAACGCCGGACCTGATCTCGTCGTGTGCATTCTTTCGTTGTCGGTAGCAAAGGAAGCAAGTAGGTAC
CAGACATCGAGACTCCAAGATATTTTTTTGCTTTTGAATATTCGTTCCGCCCCTTACTTCATTTGCCTTCATCTGCAATGTCTCGTATCGGCTTTGCTTA
TGAATGCTTCCATTGCGTTCCCACCTTCGCAACACAAAATGCTGCCACTCTGCTCAAGTCGTGTGCTGATGGACACAATGATGCCCCGTGGGCTTTGTAG
AGAGAGAGCAGTGCAGTGCATTAACCTTGCACTTGAATGCTCACACTCAGGCTGTTAGAAATGCTTGCATTTGCACACAATGGAAGAAGTTGAACGTGTA
GCCATCTCAACCATCAGGGGTTTACTCGAGCTTTCGAGCGATGACGGCAAAGAGAAATAAATATAGGGAGACAGCGAGGTCGAAACAAAAACACACTGAA
TGAAGAGAAGAAGCACCAAAACGGATTCTTTCGACTTGATAAAATTCTGCCGAATTTTGGCATTCGAGCCCTCCTCCCTCGTCACGACCGTGCTGAAGGG
AAAAGAGCCTTTATACGAGCGCCAGCCTAAGTAAATAGACTACCACACGCCGAAAAGAAGCAGTAGAAGACCGGTCTGAATATGCCTACGACGTGGAGCT
GCTCATCCTTAAATGTCCTTGCGTTGAAGTCCTGCATGGATGCAAAGAGAGAGCGAGAGCAAGAGAAATAGAGTGTCAGTCATGGTGGATGGACCACAAC
GCCAGTAAAAACACAGAGACCTGAGCCGTACCTGGTGGAAGGGATTGAGTGAGCTTGTCGGCCTTTTCAGCGTCAGTCACAACCAAGGTGTACAAGTACT
TGGAGCAACGAATCTTGAACTTCACGACCTTGTCGGCCTTCTTGATCTTCACCGAACGAGCGTCTTTTCGGCGAGCCTTCTGAAGGAAGTCGCGGATATC
AGTGATTTGCTTTGGCTGCAAAGTGGGAGAAACG