Description :
From Genome Similarity Track
Location :
contig_96:19933- 24840
Transcript NameFunction/comments
g10855.t1hypothetical protein PHYSODRAFT_509857

Sequence
4907 bases(100 bases per row)
CAAGTCGTTCTCAAATAGCAACCCATCGCGATCCCGTTCCACCCGATCGATCAGCAAGTGCAACTTCTGGTTGTTGTGGCTCAGTTGGGCAATGCGGCGA
CGTGCAAATGCGACTTGATCTTGCATTTCTCGATTGCGGACAATCAGTTCCTCACAATATCGACGCCAGGGCTTTTCCGCACCATTTTCGACTTCATGCG
ATGCATCCCAGGGCTGCTCTACCATACCACAATCAGCTAGTGTTTCACGTGCAACTGCAGATGCAGTTGGTGCCACGGTCGATGATTCTGCTTGTGTTTC
GCCTGACGAGAACGATACTCGAGTTGGCGAGCACCTCGAGTCGCTATACCTGCATTCTCGAACGAGCTCATCAAAAAGCGACGGGTCCATCACTTTCTCT
TCATCGGGGGCCTGAAGCTCGAGCGCACTATTGCTGTCAAAGCTTTCGTCGTACTCGATGCCATCTTCTTCCTCGCTTGATAAATGGACAGCATATCCTC
TACCCAACGCTTCATCGTCCCAGTCAACTTGCTGTGCGACTCCGTCATGATGACCAGGCGCGTACTGCTCTCTGATATCCACACTGCCAGAAGACAAATC
TAGCAGCGGCGACGAGTTAAACGGTGCATACTCGAGCGGGCGACCAACAACCCACTCACCCCCGTCACTGCTATCCTCATCGCTCTCACAAAACAAATTT
TGTTGTTGGGATATGCCATTTTGCTCCATGCCAGGCCGAAATCGATTGGATAATCCACTTCCATGACGCTCATAGGCTGGAGTAGGCCCCCCGGAAAGGA
TCCGGACACTGGGGCGCCTGAAAACGAACGGCGAAACGATGCCTCATCGACCATTGCAGGTGCACGCCGCTGTTCCTCCGCTGGAGACTTTACCTGATAC
TGCCGGAACAAATTGCCTCTGATTCTGCCGAAAGGCCCCCTACCCCAAGTCAACCCATCTACTGCTGCAGCGCAGCTCTTAGCCATGTCTGGTTCGTCAA
ATTCAAGAAAGGCATGTCCTTTTGTACGTCCAGTGGAACTTGCCGATGGAATAACCACTTGAATAGGGTCGCCAATCATGCAAAACAAATTGCAAGACAG
AACTTCCATCAGCTCTTCCGTGCGGTCCATTGACACTTTCGGCAGATTTGTCAGCACACAAACACTGTTGAAGCATGTTCCGGGGCGTGCATTTCCAAAC
TCAAATTGCGCCATGTCAAAGACTGGCCACTTGAAAGGGAGAAAAGAGCGCTGCTCCAAACTATAGGTAGTACTCGCATTCAAGCTGCCGGCTATATCAT
GATCGTCGGAAGGTCTTCCTGGTGATACCCAACTTTGGTCGGCATCATCACTCTCATTCACGACTTCGACATGGGCGTCACACACCATTTTCACTAACGA
CATGAAGATGTCAACATATGCCAGCTCGCAGTCAGAGTCGTAGTGATCAATCTCAAGAACGCCAGCCTCGAGTGCTGCACGAGTGATACTGTCGCGAAAA
CCAAGCCGGATCAAGTTTCCCAGCATCGCATTTTTGATGGCACGAGCTTTCGACGCGTTGATGGCTCGGTTCGAAGCGTCCATGAGCTCGCCTTGCAAGT
CTCCAGTTGTATGCTCCATTTCATATCCTTCCTCCTCCGATCCCTCGTTTTCATGACCACCGTCGCTATTCGTACATCAAGCTCTCCTTGCTCTAACCTT
CTGAGTTCAACCATACGACCAGGGGAACGCACAGGAATGCCACGACTATGTCTCAATGGAGCTACAAACAGTTCGTCATCGGTAGCGTATCCTCCATCGT
GGTTCATGTGCTGAAGAGGCATCTCGCCGACGCTCTCTGTCTCCGTGTCGTCGTCCTCTTCTGCATACTCCTCCTCGCTACCCAGGGTACTGTCCTCATT
CTCTGCACACAAATACTGCGCAGGCAACGAAGCCCTCCGCGTCTGCAACGCAGAAGCCGAAAAGCTCCGCGATGCTTGCAGCTGCAGCGGCTGCGCAACG
TCCTCGCGCGTTCTGCCCGGTCCACAGCCGACCAAAGCTGCGTCGTGCGAGCAATCAGCGTCCTGATCTCCGCAGCTTCACTCTCGATCTCCTCTGCAAA
ATCGTCTCCACTTGCAGCGACCACTGCACTGCCTCCATTGGCTTCCGTTCACAAAAGTACAAAAAGTAACAGCAATTGTAAGCCACACAAGGACTCGACA
CAACTCTCAACTTTAAATCTCACCGTCTAATTGCTGGAGCTGCAGACTGGAGCGTCTGATCCTGTTCCTCGTCCTCTGTAGCATTGCTGGCGGCTCTCCG
TCCCCACGGCCGCTTCTCTCTGGCCTCAGCTGGTCCATGGGTACGGGCCGGCGACCTTTGGTCCTGCTGCTCTTCCTCCTCTTCGTCGCTCTCCGTCTTC
TCCAGAGAGAAGAACAGGCCACTAGTGGGTACAGCCGTTTGTTGTTCGTCCTGGTTTGTGGCGTCGGAGCGCGGAGCAGCGCGCGATTCGCTGTGTATTG
GCATTCTGGCGTCTGATTCAGGACTTTAACGGGGACGTATTGCAACGAATACTTCGCGTTTCGAGGCGGTTTTCGCGGTTGAAGATAGATTGGCGTGCTG
CGCACACGTGGAGAGGGTTGGTGTAGCGCTGCGGTGCGTGTGAGCTCTGCTGCAGCCGTCGCAAGAGGCCGCCGAGGTCGTCCTGAGTGCGCGCGTCCAT
GAAAGGAAACGAACGCGCCCTTTTCGTCCAAGATTGCGGAACGATCTGATTTGACGGGGCTGGGTAGAATACATAACATAGGGTGATGTACACTATTTAG
CGGCTACCAACAGATCGTCGGCTGAATTTCAACCAATGTCAACTCGAATGAGATCGCAGTTTTGACCAATAGTGGCACTTCCACGACGTCGTGGATTCCG
GCTCGCTGTGTTTCCAGAAGTTCAAAGGCACAAAACAAAGCGCAAGCCGGAGGAGCTTCGGTGCGTGCTACTTTCTTCCCCCGTTCGTTCTGCACGTCTG
TTTGTGTGTCTAGCCGCTGGTTAACCCCTCGATCTCTAGTGTCTGCGTGTGTGTGTGAAACAGCGGCGTCCAGATCTTCCCACAAGGAGATTTAACGTCG
GATATAGTGGAAAAGGTGCGAAAACGAGAAAAAAACACGGCTAAAAGGCGCTCAGAGCGGCGTTTAAACAGCTTTCTAGCAGCTATACAAGCTGCAGCAG
CTCGCCCTGCATCATGCAGCGTGGTCGCGTGGCGCTGTATGACCTAAATGATGACCTCGTCACTGATTTTATGACATTTGTGTCGGTTTTACTCGGTTTT
AGCAGTTTCTACAGGGTAAACAAGAACAAGATGGAGGCTATCGGCCAGAAGCTGCTGGATTTCTCGCAGCCCTTCGATGTGGCGGCGCTGGACCAGGTGG
TGCTATGCATGAACGACCCCAAGAGCCCCACCAGCGGGTGGCCAACCAGATCATGGTGGCGCTGCAGGAACACCAGGACTCGTGGACGCGCGCCTCTGAC
ATCCTGGAGCAGTCCAGTAGCATCCAGACCAAGTTCTTCGGTCTGCAGGTGCGGTGATAATTGTTGCAGTTGTGACACAATTTGGAGACTCTGACATGCA
TTTGATGGGCATCAGATCTTGGAGGACGCGATCCGCTACCGCTGGAAGATCTTGCCCAAGGACCAGCGCGAGGGAATCAAGAGCTACATTGTTGGAAAGC
TGCTATCGGTGCGTTGGCGTTGGTTTATTTTTTATGGCGATTGATAGAGGTGCTGATTCGGGTGGGGTGTATTGGTTGTGTGCAGCTATCGTCCGATGAG
TCGACGCTGCACGGTCAGCGCATGTTTGTGAACAAGATGGACCTCGTGCTGGTGCAGGTGCTGAAGCACGAGTGGCCGCAGAACTGGCCGTCGTTCATCA
CGGACATCGTCAACTCGAGCAAAACGTCGGAGATCTTGTGCGAAAACAATATGACGATTCTGAAGCTGCTGAGTGAGGAGGTGTTCGACTTCTCGAAGGA
CCAGCTGACGGAACAGAAGACCAAGTCGCTCAAGGAAAGCCTCAACCACGAATTCACGCAGATCTTTCAGGTACGATTGAACGCACGGAGAAAGCGCGGT
TCGTGTGGCCACAATCGTCTTCGATCTCAACAACGCTAACGTTATGTTTTTATTCTTGCTGTCGATCCTGCTACCGTAGCTGTGCGAATTTGTGCTGAAC
AAGTCGACACACGTTCCGCTGCTTCAGATTACGCTGCAGACACTGCTTCGTTTCCTGAGTTGGATCCCGCTCGGTTTCATCTTTGAGACGGACCTCATCA
AAATCCTTGTCACAAAATTCCTGGCGACGGGCGTGTTCCGCAACGAAACCATCAGCTGCTTGAGTGAGATCGCGCAGCTGCGCGACGTCCCTGAGCAGTA
CAACAACGTGTACGTACAGCTGTACATGGGCGTGCTTAACGAGGTTGGAAAGATCCTGCCGCCTGGAAACTCGTTCACTCCGTTCTGGGAGCAGGACGAG
GTGTTTGTTCAGCGTTTGAGTATTTTCTTCACGAGTTTCTTCCGTTACCACATCCAAGTTATTGAGCGCCCGATTGCCGCTCCGGGTGATGAAGCCCACC
AGGCGCTGCTGGCGGGATTCACGTACCTTGTGTGCATTGCCGAGGTGGACGACGACAGCATTTTCAAGATCTGCTTGGACTACTGGCATTTCTTTACGCG
TGATCTGTACACGGTGGACCAGAACCAAATGAACCCGCTTGCAGGATTCCAGAACCAAGCTCGTAGTCGCCGTGAGCTTGTATCGCCCGTGATGAACCGC
GTGCGTCACGTAATGATCTCCAAGATGGTAAAGCCGTCAGAAGTGCTGATTGTGGAGGATGAGAATGGCGAGATCGTACGCGAGACGACCAAGGACACGG
AGGCGCT