Description :
From Genome Similarity Track
Location :
Scaffold_41:19933- 23137
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_41-fgenesh-gene-0.6Beta-catenin
Pytul_var.sporangiiferummaker-pug3_contig_41-snap-gene-0.38Conserved gene of unknown function

Sequence
3204 bases(100 bases per row)
ATGGACGACCACTTTGAGCGCGTGCTGGACGCCGCGGGCGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAGCGCTGCGGAGTCTCAGCAGCA
GATGAAGAAGCGCAAGCACGCGGCATCCGCAGCGCCGCTCTCGAAGCAGGAACTTGACTCGCTGCTGGCGACCACGACCGCGCAGGACATGGACCAGCTG
GACGCGCGCGCGCTCAAGTCGATGGCCACGGCACTCGACAAGCTCATCAAGAAGAACGCGCTGTTACGCTCCAAGTACGCAGACACGCCCGAGAAGTTCA
TGAACTCGGAGGTCGCGCTCGACGACGAGCTCACCAAGTGGNNNNNNNNNNNNNNNNNCGCGGCCGCGCCCGCGCTCTACCCACACGTGGTCAAGCTCGA
TGTCGTGCCCATGCTGCTGGGTTTGTTCGCGCACGAGAACATCGACATCAGGCTTGACGTGATCGCGCTGCTCGCGGAGCTGACCNNNNNNNNNNNNNNN
NNNNNCGCATGCTCGTCAAGGCGCTGCTAGACCACAACCTGCTCAGCCTCCTGGTCACGAACCTGTACCAGCTGGACGTCCCGGACATCGAGCACAAGGA
TGAAGAGGCCACAGGAGTCTATAACTCGCTGCAGATCCTTGAGAACGTGGCCGATCTCGAGCCAAGCGCGTGTGAGCAGGTGTGCAAGAACACACAGATC
CTCCCATTCCTCATGCAGCAGGTGCGCGCAAAGCGGCCATTTGGCCAGAATAAGCTCTACGCGAGCGAGATCCTCTCGATCTTGCTGCAATCTGGACCGC
AACCGCGCAAGACTTTCATGACACACGAGACAGAAGATGACAAAGACAGCAAGAAGGCGGGCAAGCAGGTGGACCTCATGGACGAGCTCCTGCAGGCGAT
CGCGCCGTACCGCAAGCGCAATCCCGCGACCGACGAAGAAGAGGAATTTGTCGAGAACCTCGTCAACTCACTCTGCAGCGTGCTGCTCGTGCCCTCGGCG
CAGACCCATTTCCGCCACCTGGAGGGCCTCGAACTCGTGCTGCGCTGCATGAAGGACCGCACGCAGTTTGTGTTTCGAGGTGCGCTGCGCATCCTGGACC
ATGCGATCATGAGCAATGCGCGAAATTGCGAGCGCTTGGTAGAAGTCGGCGGTCTCAAGATCCTGTTCTCGGTGTTCATGGGCAAGAAGACGGCCAAGAT
CAAGAACAAGAAGGTGAAAGGCGCCGAGAAGGCCAAGGAGGAAGAGAACACCACGAGCATCATGGCGTCGCTGTGCGCTTTGCTCACGCCCGAGGCGAAG
TACGACGTCTTTGACCGCTTCCACGCGAAATTCGTGGAAAACGATATGGAAAAAGTCGATCGGCTCGTGGATTTGTTTGTGAAATACCACCAGCGCGTCG
CGCAAAGCGACGGAGCAGAGGCTGAAGACGATGAGGATGAAGAGGACGAAGACGAGCGATACCTTCGACGGCTGGATGCAGGTCTGTTTACGCTGCAACG
GATCACGCACGCCGTGGCACATCTGTGCCATTTCTCTAAGAAAACACGCGCGTACGTGATGGTGAAGTTCCATGAGCGCAGCATTGACATGGAGCTGCTG
TCGCAGATTCTTGAGGAGCAACTGGAGATGCTCTTGTCGAGTACTTCAGCGGATGACGCAGATTTGAAAGCAGAGAATGACGGCAATGATGATGAAACAA
AATTTGCGACCGGAAGCAGCGAAAAGGAGAAGGAGGAGGCGCAGAGAAAGCTGCTGATGCGGTTGCTGGAAACGTTGAGGCTGGACGATATGCCTCCACT
TTCCGATTCTAATGACCAGCCAGTGAAGGAGCAACAAAACGAAGAAGTAGAGAATGGCGAGGAGAAATCGGAACCATAAACGTAAGTAGCCCTCTCTTTA
AAGATAAATGAGAGTGAACGCCTTGCTGCTGTTATTTGTGTCAAAGATACACAGAAAGCAAGAGAAAAAGACGCGAATTTCGTGGTCTCTAAAGCGTTTT
TTCATTAGTTTTGATCGTCGATGGCCATTATAATAGTTAGGTGGAGAGCGATGAATACGACGACACAGGGGGCACGGGAGACGATGGCGCGGACAACGAA
GTTGACGCCNNNNNNNNNNNNGCATCAGGAAGCGCTCTTCGTCATTGTACAGCGCCGATAGCGGCGTCGGGACCTCGTCGTCGTCAAGNNNNNNNNNNTT
CTTCTCACTCTCCAGGTCGGCACTCGCCACTCCTTCGAGCATCGGCGTCCCCGTCGCCTCTGCGATGGCGCGCTGAAGACAGTTAATTTGCTCTTCTTCT
TGTTCCTGCTTCGTGAAGACGCCTGACACGGGCAGCGTGGATTCCGATGCTGGGTCGAGGAATTCGACGGTGGACGCGCGCTTCGGTCTATCGGGCAGTG
CCGGTGGCTCGTACTGCTCTTCCCAGAGTGTCTGTGTCGGGAGCAGCACACTGGCGCGGAATTCGTTCCATGCGTCCATGGCGCCCTTGATTTTCAGGAA
CAGGTGCGGCGAGTGGGCTTGTGCCGTCGTCATGGCCTGGTCGAACGAGATCGCGATGTCGAGAAAAGCCGGAGGGGGCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCTTTGGTCCCAAACGCACCCAAGACCGTCTCAAAGCAGCCGTGGAGCAGCAAGTGGAGCCGCAACAGATCGTTCGCGGCGCGAAACGCAGG
CAGCTCCTTGCCAAACATAAATGGCGAGTCCTCGAGCGCGACGATAAAGAGCCGCGAAATGGCGCAATGCAGGATGTTGGCGCCGGGGAACCGCGAGATG
AGCGCCAGCAGACACTCCATCGTCTTGGTCGCCACAAGCTGCTTGTCGATGGCCGTGCACGAGACGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
GAGCATGAGGTAGATCACCTGCACGTGGATCGTCTTGAAGTGCCGTTGGGGTGGCAGATCCAGGATCGTGACGAATTCCGAAAGTCGTGTAATGAATTGT
TTCCACACCATAGGCAGGTCTTCATGGGGGCTGCCCTCCGTTAACGAGACCTGAACGCCATCTTCAGACGGCGGCGCATGCGAGAGGAACGCGGCTTTCG
TGACGCAGCCGCATTGTGATTGCTGCAGCAGCGAGTTAAGTACTTTGACGGCGTAGGATTCGTTTGCGAACACCGTCGGCAGCACGCGCAGGTCCTCGGC
CGCG