Description :
From Genome Similarity Track
Location :
Scaffold_77:199314- 200438
Sequence
1124 bases(100 bases per row)
GCTGATCCAGAAGGTCCCAACGACATTCATTTGGTCTCCATGTAGTCGCTGTGATTTGCATCCGAATCAGCATAGGCATAGGCATAGTGCGACGACAAAG
CTGAAGAATGTTCTTCATCTTTGACCCTAACGGTGGTCGGAGTTCGCTGTCGGCCGAGTCATAACTACCAGTGAGTGGGACCAGCATTTCGAACAGTGAT
CGACCGGAAGTATCCACCTGATCCAGGTAGCAGTCAAACAGAACCTGCGCATCGAACGTCCCCAGTACAAACCCTGCGCTTTGTAGAAACTGATAGAGAC
GTTGTACCGCCTCCATCTTGTTTGTAGCGGCTCTTGGTTCAATGGAAGGGCCTTGGATCGTCCAATCAGCTCAGGTCTCAAAATCTTGAGCACCGAATCT
GTGGACAGTAAGCCTTGAAGCTGGTACTAGTACAAACTTCGCTGTAGCTGATCAAGATTCCAGCCTTCTATCTTGACCTCTTCTTATGTACCCGTTTCAT
GATCATCAACTACAGATTCATGCGCCCTTAACTTCTAAGCTGCAGCCTTCGATCGTTTTTTCTTTGTTTTTAGTTACAGATTCATGCGCCCGTAACTTCT
AAGCTGCAGCCTTAGATCATTTTTTGTTTGTTTGTAGTTTTGTATTTAAGCAGAACATGTCCCGCTTTGGCTGGACGTGTTCCGTATAGCGGGTCGCACT
TTGCATTGCGACCCGCAGTGGTCCCCGAAGAGACCTCAGGAGGGAATATGTTGTTCTTCATAATCACCTGAGTGATCTTTCTCTTTTATTTTATTTTACC
ACAGACCTTCCAGAAAGCTGAGAAACCGAGGATCCTTGATGATCACGTGTCTGAGACGATCTCTTCTTCACCGACACTTCCATCCCCGTTCAACCTTGAC
CTTGACATGTTCGGTCTGGGATTCACGGTACAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGGAGTGGGATTCGCTCATTTCACGA
AGCAATCCCAACTCTCCACTGGAGCCCGGACAACCGACTAACGGAGGGGGTACTCTGGACCGTGTGTCTTGTCTTGTTTCTTCTCACCTTGTGTACAGTC
GGCGGGAGGGTCGCACTCTTCAGG