Description :
From Genome Similarity Track
Location :
Scaffold_1793:1993- 3743
Sequence
1750 bases(100 bases per row)
TGAGGACATGTTCTGGGCGTGGGTGGAAACTCTCCAGTACTCACCCACGGAGTTATGGGAACTCCATGAAGATCAGCAGCTGTCCCACATCCTGGACCAG
CGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGT
ACGGTATGTATTCATCGTCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTCCCAGATTGCGACAGCCTTCGGG
CAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACAAGGAGCTGTCGCTTACCGCGACACCGTTGCT
CCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGGCGCCTCCCGAGA
GCCACTCTCGTCCGAGTGCTCCGACTGCGGGTCCGACACAGGACCCTGAGGTTAACCGCCTCCGTCAACGTGTCCTCGTGCTTGAGATTGCACTTGGCCT
TGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGCCGCCTGGACCTGGTGGAGCGAGAGGTCGCGAGCCTG
CACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGTTGCCACGTCCGGAGCCGCCTG
CGGCACACTCCCAGACCTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTATGGAGCCCCTCCGGCGTA
CGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGCCCTCGTCGATGACTGTGACCGGCCCTCGCTTCGAAAAGCTGGGT
CAAGGGGGGTCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCCGTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTC
GATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGGT
AGGTTCCTCGTGTCTAGTAACACTAAGTCACCAATCTCAAATATACTTAAGTTTCCTCTTCCTTGTTTGTCCGAGTACTCCTTTTGTTTATCTTGGGCCG
CTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTG
GGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAG
TAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGGCCACGTACGTGGCGCTGCCGCGCACA
CACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAA
AGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACGCGGGTCTCGGTCCGA