Description :
From Genome Similarity Track
Location :
Scaffold_50:19928- 21166
Sequence
1238 bases(100 bases per row)
CCAGCTCACTCTTGGCTCGTACCTTGTGAGCCAAGGTAATCCCAGGGTGACATCAAATTTTCATCCAGATTCAGTACGATGAAATCATCATTGTACTGTT
CGCTCTCTGACGTGTAGTGGATTCCTACTACACGTTTCTCAACGGTTATTGAAGCGCCTGTGGCAAGGCACACCGTCATCCTCATTGGAGGGATGTCGCG
CTCAACGAACTTGAGCCTACGACCCTCTAGTGACTGACGACTAACAAAGTTGTTCGACGCCCCACAGTCAACTAGAACACGAAGTGAAAATCATTTGTCA
CTTGCAACTTCAAGGTGATGAGTGATATCTCATCACCAGGTGCAGAGACACACAATGATTGTGTATCTGGAGCAACTTTCGTCAAGAGATTTGCAAATTT
TCTTGAGGTTGCTGGATCAGTAGGGCGCTCCGCCCCTACTGACTCCGACCATTTTTTGATGGTCCGCTTCGCTGTTGCGGTTTCGCAACAGCATTGGACC
TACTCCCATTGCCCTTCTTGGCAAATAGCCGATCATTTCGCTCAGTATTGTTTGGTACTGGGCGTGGGGCACTACACTCGTAAGCGTAGTGTCCCAACTT
CTGGCAGCAGTTGAACTTCTGCAATCGCTTGTTGTTTGAAGAGCAAGGTATCTCGCTCTCAACATAACAGAGGTCCATTGGTTCTGGACCTCCAGTCTCT
TGTCGTCTCGGTGGACGATAAGAGCTCGAGCTAGCATGAGCCTGCCTCATGATAAAGTCCTCCTGTTCCGCAGCTGAGATTGCTTGTTCAAGCGTATTCA
ACTCTAAGCGGAACAGGTGGTTCCTGACGGGCCCATCTACGATCCCTTGCATGAACACAGTAATAAGTGTGTGTTCATGGACTGGATTAGGAATTATACT
ACTCGCGAGGAGTCGCATATGTTGAGCGTAAGCGTGCACATCACGCTTACCCTGCTTGAGTTTCAGAAGCTCTGACCGAGCCCTGAACTCAGCCTGTGGC
GGCTCAAACGTCTGTTTGGGCCGAGTTTTAAAGGCTTCCAGCGACCCAAAAGCATATGGGTCGCTCATCTCCAGCCCTAAGGCCCAAGTCTTGGCAAGTG
GGTTTGATCAAATGTGAGTTTCATTTGCTCATCGTCGATACGTCGTGCCTTTATGGCTCTGTCTAGTTCGACGAACCATAACAACAGGGAGTCTTCCTCG
ACTCCTCTGTACTTGAAGATATCAACCTTCAAAAATTC