Description :
From Genome Similarity Track
Location :
contig_86:19922- 21725
Transcript NameFunction/comments
g12867.t1hypothetical protein
g12868.t1hypothetical protein

Sequence
1803 bases(100 bases per row)
AGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGTCTTAGAGATGGGCCTGTGAAGA
CCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAATACAAGAAGAGTTTAGCGTGCGGCAGGCTAAACTGCATGTGAACGT
CCCGCGGCTGATGCCACGACCGGTGGTACGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACGGCTGCTGGTTCCCAGCAGCGTCGTGGA
TCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGTGATACTG
GGTATCGTCACGGGCAATCAAAAAACTAGAGGGACCAGCAGGTGCGGGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATG
AAGATCGCTGCGCCCAGTGAGAGTCAATATCACTGCAAGAAACAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTC
TTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTTCAAGGCTTGATTTCGAGGAGGTGAAAACACCTCGAAGTCTATT
GGAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCGTATCAAGAGAAGGAGTTCGTCGACGAGCTTATC
GTCCTCGAACTGGACGATAAGTTCGGTATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCT
TCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACCAGAGACAGCGCAGAATGC
GACTGTCTACGATCACCCCAAGCGAATGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAACCGAATCAGCAGGGCCTGATTCAATCGGATTCGAGA
GGGTATCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAATGTCGACACACAATTTGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAG
GCGTGTCGACTCTGGGAGCCGACGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGATCAAGCCGGGCGTGAACGCGTGCGCCGGC
GGGAAGAACCCGCCGGCGAATACAAGGAACAACTGTCCACGACCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCG
CAAGCGAGCAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACAACCGTCGAGACACTG
AGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGAGAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAA
GCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAA
TCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTAC
AAG