Description :
From Genome Similarity Track
Location :
contig_86:19922- 21724
Transcript NameFunction/comments
g12338.t1hypothetical protein
g12339.t1hypothetical protein

Sequence
1802 bases(100 bases per row)
ACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGTCTTAGAGATGGGCC
TGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAATACAAGAAGAGTTTAGCGTGCGGCAGGCTAAACTGCAT
GTGAACGTCCCGCGGCTGATGCCACGACCGGTGGTACGGCCGTCGGGAGGGTCCCGAACCAATGGACCTCTCGAGTGCGACGGCTGCTGGTTCCCAGCAG
CGTCGTGGATCAACGAATGTGCGTTGTTTTCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTG
GTGATACTGGGTATCGTCACGGGCAATAAAAAAACTAGAGGGACCAGCAGGTGCGGGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACAC
GCTGCAATGAAGATCGCTGCGCCCAGTGAGAGTCAATATCACTGCAAGAAACAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAG
AGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTTCAAGGCTTGATTTCGAGGAGGTGAAAACACCTCG
AAGTCTATTGGAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCGTATCAAGAGAAGGAGTTCGTCGAC
GAGCTTATCGTCCTCGAACTGGACGATAAGTTCGGTATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGA
TCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACCAGAGACAGC
GCAGAATGCGACTGTCTACGATCACCCCAAGCGAATGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAACCGAATCAGCAGGGCCTGATTCAATCG
GATTCGAGAGGGTATCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAATGTCGACACACAATTTGTCGAAAGACACTCCGCCGTTAGGCGTAGAG
GTAAAGAAGGCGTGTCGACTCTGGGAGCCGACGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGATCAAGCCGGGCGTGAACGCG
TGCGCCGGCGGGAAGAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAG
TGAACGGCGCAAGCGAGCAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACAACCGTC
GAGACACTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGAGAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCC
CAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGA
AGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGC
CC