Description :
From Genome Similarity Track
Location :
contig_86:19914- 21714
Transcript NameFunction/comments
g10457.t1hypothetical protein PHYSODRAFT_339433
g10458.t1hypothetical protein

Sequence
1800 bases(100 bases per row)
ACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGTCTTAGAGATGGGCC
TGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGCAATACAAGAAGAGTTTAGCGTGCGGCAGGCTAAACTGCAT
GTGAACGTCCCGCGGCTGATGCCACGACCGGTGGTACGGCCGTCGGGAGTCCCGAACCAATGGACCTCTCGAGTGCGACGGCTGCTGGTTCCCAGCAGCG
TCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGT
GATACTGGGTATCGTCACGGGCAATCAAAAAACTAGAGGGACCAGCAGGTGCGGGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGC
TGCAATGAAGATCGCTGCGCCCAGTGAGAGTCAATATCACTGCAAGAAACAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAG
AAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTTCAAGGCTTGATTTCGAGGAGGTGAAAACACCTCGAA
GTCTATTGGAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCGTATCAAGAGAAGGAGTTCGTCGACGA
GCTTATCGTCCTCGAACTGGACGATAAGTTCGGTATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATC
GTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACCAGAGACAGCGC
AGAATGCGACTGTCTACGATCACCCCAAGCGAATGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAACCGAATCAGCAGGGCCTGATTCAATCGGA
TTCGAGAGGGTATCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAATGTCGACACACAATTTGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGT
AAAGAAGGCGTGTCGACTCTGGGAGCCGACGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGATCAAGCCGGGCGTGAACGCGTG
CGCCGGCGGGAAGAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTG
AACGGCGCAAGCGAGCAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACAACCGTCGA
GACACTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGAGAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCA
GTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAG
AGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCC