Description :
From Genome Similarity Track
Location :
Scaffold_265:19912- 21153
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_265-fgenesh-gene-0.6Poly(A)-specific ribonuclease PARN

Sequence
1241 bases(100 bases per row)
GTCTTCGTCCCGTCCGCGCGTGAACGATCCAAACGCCGCGATTGCTTCATTGGGGACGCCGAGTCCTGAGCAAACCCGTAAAAAGACGACGCCAGTCATG
TAAGCGTCGTAGCCGGCTTGATGGGCATTTTGTGGCCCATTACTCTTTCCCGTCGCGGACGCTTCCTTCGATTGGGTAGCTTCACGTGTTGTAGGCCCGT
GGAACGGGTCCTTGGTCACAGTCTGGTAGACGTACTCCAACGCCGAATGCTCGAGCCGTTCACTAAACACGTCGACGTGGTCCATGGCGTGCTCGATCAA
AACCTTCGTGTCGAACACCGTCACATCGCCGAGCCACTGGTGCAGTTCAAAGAGAAACCGGGCACAGGATTCGGGGAGCGGACCATGAAACTTGTCAAAG
CACTGCATCACGTCGAGCAGCATGTTGTGGCCCACCAGTGGGACGCGCCGTTTCTTCCCCGTCTCCATAAGGAGGTCAAACACGGCCGTAAATCCCACGA
GCGAGAGGTTGCGCTGGTCGTGCTCGTCCTTGAGGACCGTTGCGTGGGCGGCTTCGAACAGCGTCTTCTCCACGGCATCCTTCGCGGCGATGATCCGCAG
ACGCCGTTTCCACGGCGTTGCTGTCACCTCTGGATCGCTGTCATTATCCGCTGGACAGTCCACGACCGCAACCGTTGGAAACTCTTTGGCCATCAGCCCG
ATCAGCGCACTGCGTCGGAACGGCGCCTGCGGTTCCGTGACAAATGTCCTTCTGGGTACACCCGCACTGTCTTGGTGGACCACTGGGCGAACGACCTTGA
TCTGCTCGCGGAGAAACCGCGCGATCGCTTTCGATTCCTCCTCGGCACTTGGCTTCACGTCGCCGTTGTCTGCTGGAAGCTTTAGCTCGAGACCCGTGAG
AACCTGGATGCGCTTGCGCATGTCTTTTAAAAACCGCTCGTTCTCTGACGTGCGAATCTTGTTGGCGGCGTCGCCGCGGAATTTCGCCACCACGTCTTCG
CGCAGGGGCTTCTGCAGCACATGCGCGAGTCGGCGCTGCTCGTCGTGCGAGAGATACCCGATGCCGTCGTCCACCCACGCGTTGAGATCAAAACCATGCT
CTCGAATGTAAGTCAGACACTTGGCCTGCACGAGGAAGCTGCGGTCGGGCAGGTCGCTGTGGTGGTTGCCCTTCGTGCTGTGGAAAAGCGGGAAGATGGG
AAACTGGAACGATTGCACTTCAAACACGCGCGCGTCGGGTC