Description :
From Genome Similarity Track
Location :
Scaffold_179:1991- 4736
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_179-snap-gene-0.13Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_179-snap-gene-0.14Rapid response to glucose protein
Pytul_var.sporangiiferummaker-pug3_contig_179-snap-gene-0.8Eukaryotic translation initiation factor 2A

Sequence
2745 bases(100 bases per row)
CATGCGGTTTGCGTGTCGAGTGACTGAATAGGGACTGCTGGGTTGTCACTTTCGTGTTGCATTCCATACAGCGGAGGCATCCACGCTTGTTCCCTCCACA
ACAGCATCAGCATCATGGTCAGCTTGGTATGCCGCAATCATTGGCACAGCAGGCGGCACACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCATG
AGGACGACGCCTTGGATCTCTACTCAATAGCAGGCGCCATGTCCCGCTCACAGCCTGCGCAAGCCATCTCCATTGAGAAACAAACTCGGCACAAGCTCCT
GCTACAGTTCTTCTTTTGCTGCATCGCTTGCTCGTGTGATCTCCCAGACGTCGATGCGCTCTGACGTGAACTCTGGGTGCAACGCACTGGACGGGATCTT
GTGCTTGCCCAAATGATGCTTCTCTAATTCGGAAAACAGCAACTGGTCCGATACAATACTCCGCTTCTGGTACGACATGAGCACCGTTGTCGGCGCTTGT
GAGGAGCGCAGCAACACGTCAAATGTCTGCACCAGCGGCGGGATGAGCTCTTCGACCCACACGACGTCCGACGCGAGCACAAAGTCGAGCGACCCCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGTCGTCGGCGGATTGAACCAGTCGAGCACTTGCATCGTGACCTCTCCTACTGCCGCTGTACCTGCATCGGTAGCAT
CATCATCGCCGTCGTCTGTACGATGCGCATTCGTCATCGTCTCTGCAACGTTTCGCTGCAAGTTCTCCATCGTGTACTCGAGGTCGGTCAAGATCACGTG
CTTCGCGCCGAGCAACGCGGCCGAGAGCCCGACGAGACCCGTGCCAGCGCCGACTTCGAGGATTCGCGTCCCCTTAATATCTGCAGCCCTCGTATGCTCC
AGGTACTTTGCGAGTACAACCGAGCCGTCCCACGTGGTCAGTCCCGTGCCTTTCCCCGAGTTGCCGACTTCTCCGACAGACACGACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTCGAAAACACGGTCGAATCGAACAGCTTGGACGGCAGCGCCAAGTGGTTCTGCTGCGCACCATCAGTACGACGGAGGATCAC
GTTCAGACGAGACCGCTTTGATGAGAGCTGTGAGACGGACTGCAAGCGCACAAACTGGTCATTCCGCACATCGTAGATCTCGACGTCAATCTCGAACGGT
GACTGCACGCGCGTTGCAGCATCTTTATCTGGCTCTCCTCCATCTGCTGCAGCCATGGCATTTGCGAGCGCTGTCTGCAGCGTGTTATGGAACGCGTCCA
TGTCTGACGGAGGCTCGACTTTCAGCGTCATGGGCGGCAGTGGCACCGATCCGGCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGACTCGCAG
CGTTAACAGCGCCTGTGGAGCGGTGGCGGCCATGACGCTAGCTGCATGCACTGCAACGGCGAAGAGGCAGGAAGCGAATAGAAGTATATGCACAGGAATC
AGTCGCGCGCGTGCTCGGCCAGGCGTGACGAGACGAGCGATGGGCTTCTTCCTGCTTGTCCCCATGAACGATCCGCAAATGGAAGCTCTTCCCGAATGAT
CTGGAAACCGCTAAGTACGGCTCTGTCTCACATAGAAAAGTGCGCTTTTCGGTTTTATCAGAAGCTTCCGCGTAAGTTCGCATTTATGATAAGTTCGTTT
TCAAAGAAAGTTTGTGTTTCGGATTTAACAGAATGTAATGTTAAGTTCGTGGTAGGTTAAATAAGTTCGATTTACGGTTCTAAGAGAGCGCACGGAAGCT
TTGGCTGGAAATGGGCTCTCCAGAGTGACAGCCATAACCAAACGTAGCAGCAGCACAAGATGGCAGCAGCAGGTACGAGCGGTGCTCGTTTGTATGGGGT
TTACGGCGTCTGTGGGTGCATGCATATGCATGTGCATAGTCGGCAAGACGTCTTCTGGGCACACGTGCCAGCGCTCCAGTAGTGCGCTTTCCACCCATAG
CGACGCTGCGCCATCCAAATGCCAACGAGATCTATGGTCGCTCATGCTGTCTTCTCGTCCGTTTTTGTAGTCAAAGAATCGGTGGCAGAGTTGCTGCGCA
CTAAGTTTTTCCTGCGCGGCAAGCAAGGCGTCGAGGCGCTCTGGGGGCTGCCGTCGTCCAGCAAGGAGCAGGGCCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCTCGGCTTCACTGTATGCAACACCG
AAGGGTACGTTGGTGCTTGCGTGTGTATAGTCACAATGTTTGCTGTGTGTGTGTGTAGCTCTCTAATGCTTGCTTGCGTGCTTGATTTTGTGGTGGCGCT
GTTAGCTCGGAGGTGGTGCTCGAGGTGTCCAACCCAGGCATCCAGGCGATCGCGTGGTCTCCGCTCGGCAGCCACTTGCTGACGTGGCAGCGCCCGCAGA
AGGAGGCCGAGCAGGGCAACCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCTTCAACCAAAAGT
CCTACTCCAGAGACGTAAGTTGTCGCTGCATTGCCTTTTTTTCTTGATTGTAGCAGGTCAGTGACAGACCCGTTTGCTTGTAGAACTGGCCGTCGATTCA
GTGGTCGTCGGACGAGACCATCTGCGGCCGTCAAAGCGCCAACGG