Description :
From Genome Similarity Track
Location :
Scaffold_324:19905- 22188
Transcript NameFunction/comments
Hyaar_Emoy2813761aerotaxis receptor Aer-2

Sequence
2283 bases(100 bases per row)
GCGAAGGTTTACACGAACAAACTGCATTCGAAATCTAAAGACAGAGCGACCGATAGTGCCCAATCTTGAGTAAAAGAGTGAGGTGATGGTACTTTATCAT
CATCGTCTACAGATACTTCTGCAGGAGCAGTCCCGGTCGATGGAAGCGCAATACCTGAAAATTCAAAGTATCCATCATACTTTTTGTACAACGAGCGTGT
GTCGTTTGACAATAAAGACGAGGTCTTACTTGCGGGGTCTTTTTTTGCTGAATTGAAGATTGAATGACATGCGGTCATGATTAGTGGGGTATGAGTGCCG
AAGTGTGCAAGAATTAGAAATAGAGATCACAGCAGACTGAAGTGCTTGTGTTTCGTGCTATAACGTGCTGAAGCTGCGTAGCCTACTTGTACATGACCAC
CTGGATCAGTTGCATACGGATTCCTCGAGGAGGCTGTGTTTGGTGCCCAGTTCCGACATCCAAACGTCATATTGTTTACTAATAGGTCGCCTACAAAGGC
AGCTTGTGTCTCGTCAAGTATGTATTGAAGATGTTGTGTCCGCATACAATACTTGTAGGGCTGGCTGCGAACGATCTTGTCGCAGAACTTGTGTTATCCG
CGAATATTGCACACGTAGGCCACTCCGAAAAGCTCTTCGTGCACGTTCGTTCTTGGAGTGACAGCAGCAAGTAGTCTGGCTTACATGCAACTGCGAGCTG
ATTTACCTGCATCGAGACATCAAGACTTCTAACACACTCGTGACTACCGTCTGGACGCTTAAGATTGCCATTTCGGAATTGCTCGGATTGCGACTGACTA
TGAGTGCACAAAATCCTTTTCCGTAAAAGTTCTCATTGCCGTCTCCTCCAACCGACCGACGTAAGCGTCATGATGACTGATGGTGATACTTTGATGCTAG
CAACGACCTCTGCGAGCACTTGGCACTGAATTTCTCCAGAAATCATGAGGAATCCCAATGATTACACTGTAATCGCGAAACGGACATGTACAGCTTTGGG
GTGGTTCAAGGGAAGATCTTGATTGACGGAGCAATATTCGGTGACGTCGACTATGACCATCAAGTATGACAGCTCGTGACGGCTGACGAGCGTCCGAACA
TCCCCTTCATCTACCTGTGGCGTGCGCCACCCCAATTCATTGAAGTTGTGTATGCATGCCGGCATCAGCGACCACTAGAGCGATCTAAGGTCCAATATGT
GATGCTGTGCTGAGGCTCGGTGTCGTACACGCTACCGAATGGCTCATGGTTTTTCTTGTCGTCTTTGCACACGAAAACTATCATGGTATTGCTAATCAAA
GTAGTCAAGGAGTGTAGTGGAAGAACTATAAGTGATGCCTTTGTTAGTTATGCATGCTAAGCATTCGTATTTACTGGCTATAAGCACTGAGTAGTCGCTC
GTCTATAAGAAAGCACTTTTTTGTCAGTGCCAATGCGTTTTCTTCAATCGAACGCTGGTTTTATTCATATTTTAACACAAAACGTTTATAACATATCATG
GTCAGACCACTTAATAAGGAATGGAAGCTCTTTGGTCAAAAGTACCACGTGGCCGGCGCCAAGTGCCCCAAGGTGGACTGCAAGGCCTGCCATGCGCAAG
TCTCAGCCGCCATCAATCGGCTGCAGTCGCATATACGCGTGTGTCCGACTCGTTCCGCCTCGACAGCTCCTCGTACAATCGCCAACAGCAATGAAGATGA
CCGTTCCAAAAAAACGTGTTTGGACGAAATTATACCTCAATCGCAAGACGGTATTATCGTACCTAATCGAGTTGCGAAGGTGACAATAGCAAGTTCTCCA
CTGGCAAAAGAACAGCATCAATCACCATCTGCTGAACGAAACGTCTCGACTGTAACGGATACGGACAACAGTTCTATCCATTCTATTGGAGTAGAAAAGA
TGGCAACGGTACAAGAGGTAGCCACATTGTCGTACTATAAACGTCGAAAATTAGAGATCGAGGAGAGTCGACTACAGCTCGAAATTAAGAGAGACGAGCG
GGAAGAGCGTCGAGAACGACTGGAGGTGGAGATTCTAGAAGCACAAGCAAGAAAGGAAAAGATGCTCGCAGAAAAAGAAGGGTACGAGTCGAAGATGCTG
CTTGCATTATCGCGGAAGAAATTGCTGGATCAGGGAGTGGATCGGAGCGAGATCAACCGGATTCTGCCGATTGTTTCGAGCGGTCCGACAATGTGACTGC
TGTGCTTTTGCTGTGACCGACAGTGCTGCTGTAGCAACAACCACAACATACATATTCAGCAGCTGGGATACGGACCCGGGGCC