Description :
From Genome Similarity Track
Location :
Scaffold_442:19903- 20955
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_442-fgenesh-gene-0.6HECT E3 ubiquitin ligase

Sequence
1052 bases(100 bases per row)
AAATATGTCTCGAGTTCTTgcATGTCTCGATACATGGGGAgATCAATGCGGTTGAAGCATGTGTGGGCCTTTGGGAATaGACTCGAGgCGTCATCTCCGC
GTGGAACGATCTGGATCGTAAACGGGTGAATGATGCCGCTTGAGCTTGTGAGTCCTTTGAATCCCTCGACAGGCACACGACTCGTGCCCGTCGTAAACTG
GAGAAGCCGAGCACGCTCTTCGGGTGTAAGGCACTCCACAACGATCCAGAACCACTCCAGAACGCTGTCTTGTGCCTCTTGTGTGATCTTGTTGTGTTTG
TTGTCCTCTTCCTTGAGGTAGCGCACCTTGGTATGAGCCTTCCAGTCAGCTGTGTCGATGGTTGGAATACCACAAAGCATCAACTCCAGTTCCTGGTAGT
CAAACACGGACAGTAGTGTCTTCGGTACGACATCGTAGATTCCTGTGAGGAACTCCTGCAGCTGATCAGAAATACTTGCAAGCATGCGGTGCTGCAGCAC
GAGTCGTAAGTACTCTTCCTTGTTCTCGTCAATCACGTCGATATTACGACCGTTCTCCTTCAGGTCGATTtCCTTGCCGTTTTCAAGCATGATACTGAAC
GTCAGGCACAGAGCGTCGACTTGGGAGTTCTCCTTCAGCCACTGGCAGTTGCGGTGGAGATcTtCGTCGAGGAATTCGAGATCGGAGAATgAGATGGGGA
CACCAAGAATGTGCTTGAGCAGTGGCAGAGCCAAATGCATATCTAGCACAAGCCCCTCGAAGAGAGCCTTTCCGATGAGAAGTCCTGCGAATCGGAAGTA
CTGCAAGTGCTTTTCGTtCTTCTCTCCGGAAAGGGGATTGATCCAGTAGCTCATGTCTTCACCCTTGGTTGGAAGGAAAAGGCCGAGCTTCTCACTGAAG
ATCTCTTTGCAACACAACGCGAACCACTCACGCAAGAGTCCGCCAGCGTCAATACCGGGCTCTCCGGCGAATGTGATCTTGAGGTAGGTATGTAGTTCTT
TAGGCGTCAACAACGAAAGCTTGGAGACGGACTCTTCCAGCATTGTATCGCG