Description :
From Genome Similarity Track
Location :
Scaffold_53:199005- 228806
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16078myosin-like protein
Phypa_INRA-310PPTG_16079hypothetical protein
Phypa_INRA-310PPTG_16080hypothetical protein
Phypa_INRA-310PPTG_16081hypothetical protein
Phypa_INRA-310PPTG_16082hypothetical protein
Phypa_INRA-310PPTG_16083hypothetical protein
Phypa_INRA-310PPTG_16084hypothetical protein
Phypa_INRA-310PPTG_16085hypothetical protein

Sequence
29801 bases(100 bases per row)
TTGGGACTTGGGGGGCTGCTTGGGCGACGCTGGTCTCCTCACAGTCGGCTGGGGCTTTGGTGCCGGCGGCTTCCTCGCGGCATTGGCCTTCTTGGGCGGA
CCTGATGGACGCTCAACGTGCGTCAACGGGGAGCCGTGTGACGCCGGCACTTGGTTCAAGAAGGCGTTCAAACGGTTGGCATTGGCACCTCCGCTGTTGC
TCCTTGTGTCCTTCGGAGGTGGCTCCACAGGCGTCGAAGGCGGGGAGTTTGAAGGAGACACTATTCCCGCTCCAACTTGCGGTGACATTGGTGGAGGCGT
CGAAGGGGGCGTTCTCTCGGGGGATTTGTCCACCACCTTCTTGCTCGACTTCTTTTTTCTTGATAAAAACCCGCCTTTCATGAAATTCGTGAGTTTGTTG
TTACTGTTCGTCTTCTTGACAGGTGACGTGCCCTGCGAGCTGCCTGTGGACGTCATGGACTCTGCATCTGATACTGGATCCTCTTCGTACTCGCCCGTGT
AGCCGATAGTGCCGAATCTGTCGAACAAGATGGAGAGCGTCTCAAGCACGGTAGTAAAGTCGGCGCCGGCGTCCAGTAGATCGTCAGGCTGGAAGATTTC
GCCCTCGTTTAGACCCTGCTTCTTGCACCATTCGAGGAAGAGACGAATATTGGCTTTCGAGTGGAAAACCGTGTTGAGCTTGTTCACTTTGAGATTGGCC
GTCGGGTCCACACCATTAGCGAGCAGACACAGTAACTGGCCGTCGCGAAGCATAACCGACAGGTGCTCGCCATGATCGTTGGCCGTGGCTGTGACGCTAC
AGATCCACTCCTGCAGCTCCTCTGTGCGGCGCACCGTCATGCTGAAAAAGAGACCGACTCTCGACTAGATTGCGTCTGTTGTCTAGCTGGAGCCCGTGGG
AGAATAAGACGAAGAGGGAAGAGCCTCGCTGGTCTCCTTTGGCCTCTCGTAGTAGAGCGCAAGTTCGCGATATGAGCGGCTTCGGGACAGTGCACGCCTC
TCGACACGCGACGACGAGATTTTCCGCACTACCAACACGACTCGACGCTGCACGACTTGCTCCACTTGGCGCTGGACCTAACGGAAACTGACTCCTGCAA
ATTGCTGCCAATCGCGAGTTGCCTTTTTGGCAGAGAAACCTTCCCCTTCTGTACTCTTTTACCACTTACAAAATCCTACTTACAGGGCCTCGCCAGCTGT
TGGGAAAGACTCTGAGACCAACGAGAAGGCGACAACCTGCTGCTGAGCACGGTGAAGATGCCGAGACATACACTCACGTCGCTAAATATCCGTAGGTTGG
AAGCGAGTTTGAAGCCAAATACGATGAAGTACCCGTGAAGCTAACCTGCTAGTTGCTGGATAGCGCACGTTTCGAATGGATATTTGATGCCGTTCACGGA
GCCGTTATGGGGGAGGAATGGTAACAACACAAGATGTTGGCAAACTGCCGCAACTTTGTGCCTCAAAAGTGCTGGCATTCGTTACTAAGGTAACTAACCC
TTGCTCACATTGACATTGACTGCAAAGCCTATCGGGCTAACAGGATGGCATGACTCTTCCATCCGCGGAAGTGGAAATCTCCGGTCAGTAAACAGCAACT
CGACTTGCCACAGGATTTCATCGTTGCCATCGCCACAAACTTTGTGCTTTGTGACAAAGCACCAGCTAATATTGCCAATCAGAGCGAACCCACGTCTAGT
CTGCTATCTCTGATCCTATCCGGAGGCAATCGACATCACAAGCCAGAAATTGGCAATTGAATTTGTGAACGCAATTTGCCTTAGGCAACTGCCTCACATA
AGCACCAAAATGGTGGTCTGACACCGAGAAGCCAGACTCATCAAATACTTCAGAAGTACCAGGAAACTTGAGTCAAGTCAAAGTCGATATTTTCCACTGC
AACTGCTGCAAACGTAACATGGCTACACCGAAAACGATTCAGCTTTATCGTCAGCCAATCAAACGCCGTCTTGAAGTTGGTTCGACAGAAGATCGTCTGG
TTTGGGTAATTGTTTATTGAGAGAAGAACGATGCGACTCCTGCGGCTAGTGCTCAGCTTCGCGGTGCTGCTGTCCACGACCAAAGCCAGCATCTTCGCGG
GATACACCGTGGGTCGACAATTCCAGTACATCGGCAAGTTCTGCTTCTCCTGGACGTCTACACTCGACGACATCGCGGGGGTACGACTAAAACCTAAAGC
GAAATATCCAAATCCTTCTAACCTTAACATTCATCCTTTCTAACGTTGCTACCAGCGCATTGCGGGCGAGATCGAGACGGACGTGGATGGACTCCAGGTC
GCCATCTACGACGACGAAGCGCTCTTCTGGAACTTCGTCATGACCGACATCTCCTGCGACTGCTATTGCAAGGTCTCTGCCCAACACACCAAAGGCGTCT
TTAACGTGACTGCCACCAATAGTCACCACGTAACTCCGTTCACCTTCAACGTGGACATCCGCGAGCATCTACGACCAAGGTTCTGGTATGTAGCGCTCGC
ACGTTGTGTACCGGGAGGGGACCAGTACAAACCCTCCTTCACAGAGATCACAGAGACCAACTTTCGCAAATACTACTTCTCCTCATGGTTTAAAATCCAC
ATGACGCAGGGAGATGGGAGTGAGCTTCCCGTGCAACAACAAGGGCTGCCAGCCATCTACGCAGTCATGGCGGCGGTGGCAGGAGCTGCAGCAGCGGCAC
AACTTGTGGCAGTGCGGCGCATGAGACAAAGCGAGTCATTCCACCCGATCATGCGGATTTTGACGCTAGTGGTGCTGTTTTTCTTCCTGTGCAACGCGCT
GCTATTCATTCACTTTACTACGTACGAGTTCAACGGTCTGGGGGTACCGTTTTTCAAGTACGCGGCTAGGATCACAGACGTATTTGTCCGCGTGGGCACC
TTATTACTGGCCATGGTGATCGCAAAAGGGTGGACAATCAACAGCGTCACACTGGATGGCCAGATCAAGCTTTCGTGTGTTATTCTAGCCATTCTCGTGC
TGTATTTGTCCATGGCGATGTGGTATCTCGTGTGGCTCGACCCAGCGTCGACGTTGTACATTTACGACTCGTGGCCGGGACTTGGCATTTGCTTGTTGCA
AGTGTGCGTGCTAGGTTGGTTCGTCAACACCATTCTAGAGACGCGCTCCTACGAGAAAGCCTCGACAAAGCGGTATTTTTTCCTCAGAGTAAGTACTGGA
AGTGATACTTGTTATCGGACGAATCCTGTACTTACTCCGCGATTTTCAGATGTGCTGCCTGTTTTCGGTGTATTTCGTAGCCCTGCCTATTATCGTGCTC
GTTGCTTCCTTCTTGTCGCCGTGGGTGCGTGAGAAGACCGTGGCTGCCATGACGACCTCAGTGCACTGCTTTATCTACTTGTCTCTCATTTACACGCTGT
GGCCGACTAGAGCACCACGCTACTTTGAGGTACGGAAACAACTGCATTTGTTGGTGGGACTGGCAGGATCGCTAAGTTTCATTGGTGTCGAACATGTAGC
GCCTCTATTCCGTGTCGTCTCCATCCGAGAAAGCGTCGTTGCGTGACCAGCATCTCCCGACCGAAGAACTTTAAACCGCTCTCACTGGTAGTGATGCTCT
CCAATTTGACGTAGCTAATAGTTGTTTTTTTTTTTCGTTCCAGTCGATTCAAAACACATTGACGCAGTTCTACATGATGGTCCTGTTGAGATGCATTCTT
GTCTTCCAGTACAGTGTGAGCGTTTGAGTCTCCAGGTGCGCCAGCTGTGAGAGTGCACGGAGAACTTCGTCGGTGCAACAAGCCGAGTTTGGGTCTTCTA
TACTTCTGATTTTCAAAGTCAAATCCTGTGAAACAAACCAACACACACGAAATTAGCAAGACCGAAACAGCAGTCTGATAAAGCGGCAAACAAACCTCCA
GGAGATTATCAAGATCCGCTATAGGCTCCAATATTTCGCTGACATCCAGCGCTAGCTCATCAGAGCGGTCTTCTTCGTTGATTCCTGTAGGGCTTCCATC
GTTCCAGTTATTGATCGTCTCCAGAACCAGGGCTCGCATCTGCGCGATATGACAGTGTAAGTATTCCTAGAAAATGAGAGATGAGTTACAGTAATGACGA
ATACTTACCGCAGAGAGATCGGCCACGTCGGAACATTGAATAGTGAGGTCAACTGATCGTTGTTGGTCTTCTGAAGGAGTGAAACGAAGGAGTATGAGGC
TTCCGGAAAAGGCTCGTAGTACCGTCCAGAGCTTCCCATGCTGTGTTCGGCAGCTACGACGCAATCGTGGAACCTCAGCAGAGGGTATCTCCAGGAGCTG
ACGCAGGAACGATACCATCCTCTCGAGGCGGAGTTTTTCAAAATTCTCATCTTCATCCTCGTCATCCTCGTCGTCTTCGGTGGCAAAGAATGAAGGGATG
GCTATAACAAATCGGGACGGAGGAGTTAACGCCAGAGGTGCAGCGTCAGAAGGCGAAATTTTTGACCATAACGCTGCGAACGATGGATTCCTATGAGCAT
GGTCAGTGAGTGCAGCCCACCACTGCACACCACTCCAGAGAACAGACGAAGACGATTTTCCCTCTTTGGTTGCTCTACCGACTGGCATGAACGGCTCGTG
GCTTTGGCGGAATGCAGCGTGAATGGCAACTTGGCTGGTTGGAATCTCTTCCTCGATGGGCCGACTCAGCTGTGCGAATAGGAATCTTTTGTCTTGAAGC
AGCGGAATTGCGAACGACAATGGATCATCCTGAGCAATAATACTCGCACCAATATGGCTGGTATTGGACCGTTCATTTTCTGGATATCCATTTCGTGAAG
GGCAAAATACCATCGAACACGAGACCCACAAACTTCCCTGGTCTTGCTGTGTGAGTGTATCTGGATCGAGGATAATGCTCTGTTCTCCGCGCGCTGTTAT
ATCGTTCAGCGGAAAGGAACAAGTCGTGATTGAACGTTGATGAGTACGCACGTACAGACACAACCACCTATGCCCGCAAAAACATGGATTGAGTGCCAAG
ATTCTTAATGAATGTTCATGTGAATGAATGATGCACAACAGCAGCCACGTACCAGTCGTCAAGTGAGATAATAGCTTCGGGATTCACGAAACCAAAGGAG
CAAACCAGTTGTATCGCCTGTCGATCTGAAAAGATCCCAGTCATTGTCATCGAGGCATTCAAGTTGCACTTGACCACAGACTCCACACCTGCAAGGAGAC
ACAGCAACAATTACCAGTTGAGACGCACAGATGCTGCTGATATCATGACCGATAACACGAACCTGTAGTTTCGACAAGCCGAAGTGTTTCCAAAGCAGAG
TGCAATGTCTTGAGCTGGAAGTCCATTTGCTTCGATTTAGTGCGCAGATTAGTTGACTCGGAGGAAATTTCAGCGATTCGATGCAAAAGATTGCGAACCC
GAGACTCACTCCCTAGTTCGGATGACTTTCCACATTTATGGTTTTGTTGTTGTCCAGATAATGGTAGTACACTTGTTACCATCGTGTGAAGAGCTGTGTT
ATTGATTGTTGTGATCCGCCCTGACGCAAACAGAATTGACAAACCACCTTCACTGCCATGAGTTGCTAAGCGGATGATACCCTAAATCTCACGCATACCT
CGTCAACTCGGATTTCAACTCAACGAGCAAAGGGAAGGTGGATGACACGTACCAGTTGAAGGGGTAGCTTTTCAGTAGAAACATTTGAGCCATCACTGAG
GCTAGTAGGCGCGTTTGAATCTATGGATTGAGCTTGAGATAGTAAATCGGTGCTTCGACACACAAACGCTGACCCAGTCGAGCAAAAGGCAAACACTGCC
AAACGATATACAAATACCAACGACTGTACTGCGCACCCAAGCTCCAGCTTCTTCACTGAACCAGAAAGGGCTTCCACCGAGCAACTTTTCTTCACTTCAA
CAATCCTGATCCTGCCTCGAGCACCCAGCACTAGCAGTGCATCAAACACTTGAGATGTCGCTGTTGCACCATTTCCTTCCGAGGATGTAGTTGCAGACGA
CGAGAACGGGACGATCATCTGAACCGGCTCACCCAGCCGAAGCAACATACCACTGCGAATTACGGACGCCTTGATACCACCTCTTTTCTTATTTGGATAA
TGCACCAATGAAAAACGTACATAGCCATCCAAATCTCCCTGTAGAATAGCGGTCACACCCCAGTCGGTCGCCACGTCCGGAAACAAACGCCTCAAAAGTC
CACAATGATTCGCCATCTGATCATTCAAACAAAGTGTGCAAGTAGACTGTTCTCCTTCGAGCTCGCCCAGCTCCAGCGATTGATGACGCTGCAACTTCGA
CCCGGAGCTCCCGTAAGTGCTCACGATCAGCGTGGTCGGTGTCACCAAGCTCCTCATCAGCGTCAGCGATGACAACCCGGGTCCAGCAGGAATGTGACTC
ACGGATTGCACTCCAGGCAGTTGACAGAACCATTGGACCGATTTGTCATCATTCTCACAGGACGAGCGTTCCAGCAGCAACTCACGTGTCACCCCAAGCT
GCAGATGACCAGGCAACGTCACGACCCACACATTTCCGTCTGCAGTGGATACCAGGAGCTTGTGACGAGCTTCACCGTGTTCAGAATGATGGCCGCCATA
GTCTGCGACGTCCGTGATTGGCACATTGGACCTGATCACACACTGAAAGAGGATTATAGACTTGCTTTAAGGATCACTGTTGCGATTCACTTACCCGCAA
TAGATTGGCAGCCAGGAAATGCAGCAGCGTTGGGCGGATTTTCACGACGATGCATGCGCACGGAGGTGCATTGTCTGTTGTGTCATTATTGGTGCGTAGA
GTTAACAGGAGCGGCAAGCAGTCAGCCACACGGGCCAATTGTGTCGACGAGCTCGCCATTCCAATTTTTTTATAACTAGCTGGGCAACATCACTGGCAAG
AATTTTTTTTTCAGAAAAAAGTGCTTTATGACGTTTTCAGATTTTTTTTGAATTCCATTCCGATTCATGTCCTTAAAGCCAGGAGCATTCAGACGAAAAA
AACATTAAAAATTAAATGTTTTTTTTTCGTCTGAATGCTATTCCGGCCAATCAGATCTCCCATGGCAGTCAACCAACACAACTTAAATGGGAATGGAAAA
ATATTTCGAGAGATCTGAATGCCATCCAACGGCAAGCGACGTGATGTTTCAGGGACGATAATCGCCCAAAACTATGTACTATACACAATTTTGGGCGCCC
TGGCCAATGATTGTAAAAAACTATTTCGGTTATTTCCGATATAAAATAGAAATATTTTTTTGTTATCTTTTATGCGATAACCTGTTTATACAATATGGTT
GAAGTACTGCTTCATATCGATTAATAGCCCCTACTGAAGCCCTATGATGGAGGGCATTTGGTGGATAAAGTGATAGCGTCTCTTGCTCTTTCGCGGATGC
AGACGGGATCGCTAGACGCTGCTCGACGCTGCCGCCGCTCTTCTTTAAGTATTGCAGCACGCACAGCCACCGCGACGCTCACATTGATGTACTGGTCGTC
ACTATATAGAGATCGTGCCTTGTAATAGAGGTGGTTCAAGTCATACAAATCTGGAGTTGATAGATGCAGCTGTTTCAGGTACACATACCACATAAAAAGA
AAAAAATATTTATATAGTTTTTTGACCATCCCTGCCCACGCGTCTCTTTGCCGTAAGATCGACTCGCCATGGTCAAGACAAAGTCAACGACTTCCATTGG
AGGCAAGTAGCGAACGACCAAAGGTAAAAAAAAATAGACCTGTAACGATACGCACCGCTACCCTCATAAGAAACAAAGTCTGATTAAACGGACGTTCTTG
ACTATCATGTATTTAGCGCGTAGCGTAGCGGACAGCCACGTCACATCAAATACAACAGGTATGTGTATTACTTGATTCTGTTATTACCAGGGAGTTGTGT
TTCTTTAGTGCTCTATACGTCATCGACCCCTTGGCGATTCTCGCGTCCAAGGCTGTTACATTCAAAATCGAGTACAAAGTTTTCTATGAGGACGCGCAGG
GCTCCATCGAGCAGAAAACTCCCACGCACATATCCAGCGAGCTCAAGACCTCGACAGAAGCATCAAACGTCAATGCTACTACAAGCACAGAAACGAGATT
GCAACAGGACTGCTGTGCTCGGGACGTGAAGGCAGCGAAATGTCTTCGCTGTAAGTAAAATATTATGACATAAGAGTGACTATATCTAACAATTAAGAGT
TGCTTATCACAGTTAAGCACCTCAAGGCGCTGCACGTGCTCCAAGCTGCACATGCCCGCAGCTTTAAGAAAAGCGAGAGTCGCAGATGTGGTGTAGCGAT
TTCCGAATAATCGCTGAAGTGGCTACATTCAAGTTGCTCAAGCCACGAACGCTCAAGAAAGGACAACGAGGTGCAAGAAAAGCAAACTTCAGTGTAGGTG
ACTTCGTTCTTCACTCACGAGTGGACCAGAAACACCAGAACAAGATGTTGGTGACATGGAACGAACCGTTCCAAATCGCGAGAGCAGACATGTATTCGTT
TGCAGTCAAACACCTTGTCATGGGTGCAGAGTCGGACGTGCATGCGTCTCGGCTAAAGTACTATGCTGACGAGGACTTCGAGGTGACTGAGGAGGTTATC
GAGCATGTTGCATCTCAAGGGATTGTACTGGCGGTTGCTGAGCTTAAGGAACACAGGTGGTGCGCGCCAGCTGTGAGAGTGCACGGAGAACTTCGTCGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAAGCGCTG
TACAATGGACACAAGCGAGTGCATGCATTCAAGTTCCAGACGGTCGTGGCACCTGACGGCATCATTTGTCATCTTTTCGGCCCAGTGGATGGAAGACGTC
ATGACATATACATGCTGAGACAGAGTGGCCTACCAGAGTTGCTTGAAGACAATTTAGAGTTTCATGGGAAGCTGGTGTACGGTGATCCTGCTTACGGGTG
CACTGACGTGTTCTGCTGTCCCTACAAAGGTTGTAGCATTAACCCTCGCTAGCACGCGGTGAACAAGGGTATGAGCTCTAAGCGTGTGTCGGTGGAGTGG
TCATACGGCCGGATAACCAGGTAGTTTTCGTATCTGGACTTTACGCGGCACCAGCAGCCTGCAACGACTCCTGTTGCTACCATCTACAAGCTCGGGGTGT
TGTTTACGAACTGCATAACGATTGTACGCGGTGGAAACACAAACTCGCTCTTCTTTGGATGTAAACCACCTACGTTCGAAGAGTACTTCAGTTCTACCAC
CGACTAAGTCGATAATAATTAATTCGTTGGCTTTTCTGCGTCGTAGAATATCAGGAGAAACTCACCCACGCACACCAATAAAACTCTGAGATTCCCAGCC
GACAGCACTCGAGACGCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAATAATTAATTCGTTGGCTTTTCTGCGTCGTAGAATATCAGGAGAAACTCACCCACGCACACCAATAAAACTCTGAGAT
TCCCAGCCGACAGCACTCGAGACGCCGGCTAGAAGTAGCAGCAATTAGTTGCTAGCTGGAAAACGCTCATCGGCACCCCTGTTGCCAACTTGATTTTGAG
AAGCCTGTAATTGCAGCCTTAATAGTGCAATTTCTTGGCGCCGAATCTGCATTTCCTGGCGTCGTAGCTCGACTTCGTCGTTCTATTTCCTTTCAGCCAA
CTCAAGCTTCTTGCTTTTGAAAGCGAACTCGCGGTCCCAGCGAAGCGCTTCCTCCTCACCTTTTTGCTTCATTAGCTTCAGTTGTTGCTCTAGTAGCGCG
TTGTCTTCGTGGTGACTCATTACCTGCTGCTCCAAGTATGCTGCCAGTGATCCGTCTTGAGCAGCTTTAGCTGTCTTGCTGTTTTTGCGATTCGAAGTCC
CCGAATAATTACCCGAGGAACTGTCTCTTGTCGAACCCGAAACGATCGCGCTTTCGGTACTGGGTGCACTCGATGAATCCTGCTTCGACTCCTCAGTAGC
TGCATCTCGTTCCGATCGACGCTTGACAGCCATTTCCCTCAGAATCGCACCCTATGTCTGCAATCGATCCTCCTTGTCTTTCTTTTTCTGCTTCTCGTCG
GTTTTCATCGCCTTCACGTCTCTAATTCGGTCCGATAGATCTAGTAGCAATTGCTTGTGCTCCTCGTAGTTTTTCGCTACTCATGTCTTCTTGCGGTAGG
CCTGATCGTTTTGTTTAAACTCATCCAGGAGCAGTGCAAACCGCTCTTGCACTGTTCTCTTGCTTAACTTCTGGTCTAATTTGAGGTGAGCGCTCAGATT
ATCTGCCACGAGTTGATAGCGAGCTCCAATTTTGCCGTGGCCTCCTGCAAAAGGCTCGTTGGCAAGCATCTCTTTAAGGAGCGCCAGATCTGCCTTCTGG
TCAAAGAAGAACTTCCTTCGCCTCTTCTTGTCAGCTTTTGATGCGATCTCGTTCTCCTTGTCCTCGTTTTCGTCGTCGTCATCAGACTTCTTGCTGCCCT
CGTCAGGAGACTCATCCCACGAACTTAAACTTTTCACATCAACACCAGCAAAGTCATGGCACGTAAGTTTGGCTTTGATACCACCTTGGCCTGCGCTACG
GGGGCGCTTGAGGTTTGAGTAGCGGCAGCGTCAGTAGACACATCAGCAGTAGAGTTCGATCGCGAGCGCTTGCCAGCAGATCGACTGTTATTCGATGGCT
TGAACTTGGCAGCTGCAGCACGACTGTATCCAGGCTTGCCATAGCGTGTTGTTTCCTCAACACTTGGCGCGCTAGTACTAGAGGTTGATCTCGGCGTGGC
TGGCTCAGTTGCCAAGCCCTTGTAGCCCTTGGAGGTGCTTCCGGAGATCAGACCGACGCTTCTTCTTCTTTGACGCGCCCCTTGGTAGCCACAACGCTTG
TTTCTGATGGAGCGGAGTTGCCATCGGGAGCAATGGCACCAGAAACGATGCTGGTACAAGCAGGCGAGCATGCTCTGGAACCTAAATCACCATCGAGCAC
ACTGTTCGAGCAGAAATGGTGAACGTAGTTCCCGCAGCCCGGAGCTGAGCACTCTTCTGCGACCAGCACTTCATCATCAGCTGCTTCACAGTGCTTCTTT
TCATCGATGTAGTAGGCGCATGGGCCTTGTATCGTCTTCGACTCGCCAGGCATGTCCAGACAGCAACTTATGCACCCCGCGCAAAAAGTCCGTGCGCTTA
TCCCGTAGCGAGGGTGCTGGGCACGGGTTTTCGGAGCCGAAAAACTCGTCCGAAGAGGCGCGCCAGAAATAGATCGCCGAGCTACGTGAAAATGACTACA
AGTTTTTTTGCAAAATCCGGGGTTTGAAAGGCTCTAATATCTTCCGAAGTATAAAAAACGTGTTGAAACCCACAAGTCGTTATTTTGCAAATCGGTTTCA
TTCGTAGTACAGTTGGATCTGTCAAATCGACTAACAGTATCGCTATTTTAAAAAAAATTGTTTGTATTTTAAAATAAATTCATCATTTCAATTTTTCTTG
CAAAAATATATTTATTAAAATATTATTGTGTAAAATACCGTCGAGACCTGAACATTGCGATGGTATTCATCCCGAAATTATGGGTACCCTAGACAAAGAA
TGGGTAGGGTGCCATTCTTTGGGTACTTTGCGCTACTTTAGGTCGATCGCAAAGTAACGCATCACAAACCGACGCGGGGCCGCGTCGATGTATGGGATTT
TATATTAGAATCTTACTGAAACCAAGATGCGGGACCCCGGAAAAAATAGTCCAGAGAGATAAGCCTTATTTCAGGGGACGATTCCTTTTGTGAAGGCCGT
CACAATTTGCACGAAGCCAACAGACCATGGAGCAACTCTCCGAGGGCCTCTTGGCGCACCTCTTCTCGCTGCTTTCCGCTCGGGACGTGCTCCAGGTCGT
CTCCACCTGCCGGTCGCTGTCTCCATCCACTCCATGCGTCCAATCAGCGCTCGAGCGCGTCATCAATCATCGTTTTGGATCCGTCGCGAGCTTTTTAGAT
GCCTCATCATCCCATTGGCCACGATCGCTTGCTGTTTTACGCGGTACCGAAGTACTACGCATCAAGGAGCTTCTGGCGCGCTCATCTACCTGGTCATTCG
AAGACGCCGCCTCATGCTCTCCCAACTGCGTCGTCGTGAGCCGTGCGTGGCTTGGCGCCTTCAGGAAGCGCTGCCAGGGTTTCGAGCAGTATTTACAGCA
GTTCCGCCGTACTAAAAGACAGCAGCGGCGGCAAAATGCAGCTAAAAAGAGGGACAGTGTTGCATCCGAGAAACTAAACCTTGCAGCTAATTCGACACTC
AGCGAGGCCGGAGTCATGATCGTGTGCGCTCACGACGCACTGTTACCGGCTACTCAGTGCGTTGGTCGCAGTCGTCGCGCTATTATCAGTGGAGACGTGT
TCAGAGAGATCGCTGTCTACGCACCGGAGCTCAGAGGTTTCAGCTTGAGATCGTGCTGTGATTGTACCATGTGTGTACTGGAGCAAGAGACGAGGGAGCT
GGAGGCTGAGGAGAAAAAGAGAGTGAGATTCGACGCGGAGATTGCAGGATCCGAGGAGATGTTGGAGCTACTACAGAGGAAGAACGGGTTCCCTAAGGGA
CTGTTCTCGCCTGTGGACACAGTGGGAAGCAGACAGCAATTGGCACAGCACTGGTCGGTGAGTGGAAGGAGCAAGTACGCGACGTACTTCTTGGTGCCCA
AGAAATGGTTGAACAAATGGAGGAAATTTGTTCGCAGTCAGGGAGACGATAGCCCCGGTCCAGTGCTAAATGCCGAGCTAGTGTGCTTGTCGCACCAGAA
AACCATTATACCGCCCTATATATCAATGTTCCTGTCCGGGTTTTCCCTTGAACAATCGCTCAAGGCCACCCAAGCGTAAGTCATATCTGCTTGAAGGTAG
GATTACATTCTTACTTACTGTTATGTTGACATGCAGTCTAGGATCCACCCCAGCTCGCCAATACGAGATCGTGACATTCGGGGAATGGGAAGCGCTATAC
GATCGGTATTGTGCTGAGTTTGCCGTTGGCTTCGACGTGATCAATGGGGCATATCACTGGAGGACACAAGAGTGCCAGATATGCAACTATGGAATGGGTG
GCGGCCCATCGTCGAATCAACCAAACTCACGGCGCTGAAGTGGAATCATGAACGATCGTACACTGTATAAGGCCTCGTTACTGCTTCCATGCCGAAGTAA
AAGAACGCTGAGTCAGTCCCCTTGACCACAACTTCGCCAATATTCAAGCAACAAAACAGGGCATACATACACTAAAAGTATGCACACTATATTCACGGAT
TCACAAACCCTAAAGTATCAGCTTCCGTGCCCCCTGTCGAATCTATCGGCGGTGGCTGCTCGGTCGAGATCTTGGTCATCGGCCTGCATTGACTCTAGAC
GTGGTATACTCAGGATGACTTTCAATAATCGACTCATCCATGTCTCCCTCTTCGATCTTTGGCATCATGCTGGCATATTCGGGGTCTTCTTCCTCGTTGA
GCTTCGTACGACGGAAGGCTTCCATCATAGCGGGCACACTAACGTTATCGAAGCTCAACTGACCACCGTAACGCAGCATTTGAGCTTCGTAGGCTGCGTA
ATTGTAGGCCTGGAACCAGCGCTTTCGCACTTCTTTTTGAACTTGTTTCTTGCGCTGTGCTGTCGTCTCAGCAAATATTCGTCGTGACTCAGCGAGTCCT
TCTCCTATGATCATGCTGATCCCAAACATTGTGACTGCAATGCACGTTCCTACAAGTAGGAAGCTGAGCAACTGCACGTTGATCAACGACTCAACGTTTA
GGTCGTTCAGTCGAATCATAACTCCGAGCCACAACGTGAAGAAGAGCTGCAACTGGGTGATACTCGCGATGAGATTATCCGAGTAGCCGTCGTACGGTTG
GAAGTATAGCAAGAACCACATCGTCGTCAAACTGTATCATGCAAATGACACGTCAATACTGGGTTACTCTGATCTAGCAGATAGAATCCAAACATACCAG
ACAGCTAGTGCCAGTAAAACTTGCTCCACACTTCCGTTCTCCACGAACACGATCACACCACTGAGGAAAAGCTTCCGTGAAAGATCCACGACTTCAAACC
ACCAGTAGTCATGAGTATCTGCAAGAACAATCACAAATTTTAGTTACGTGTACGATCCAAAGGAAACTCAATAAAGCGTACATTCGGCGTAGATAAAACC
GAGCCGCGCTTGCACCGTCGAGTCCTATTGACAAAAAATATTGTAAGTAAAATTAAAAGTTTGCGGGATTGCTGTAGCGTACTGTCAAGTTCTTGCGCTT
CATGTACTTCGTCAGCTCCTCGTCCTGCACCTCGATGTTTTTCATATCTCGAACAAACCGTCCATCTGCTGTCTGTTGTTCTTCCACCTCCTTAAGCCAC
TTATGCCGTTGCATGCGCATCTGAGGCTTACGCAGTAGCTTGATACGCGCAGCAACTCCACGGTCCTGAGCTAGCCAGATCAAAAGTCCGAAGAAGAATG
GTATTCCCACTACCCAAACAATGACTCCGATCGTCGCAATCATGCCAAACACCGCCCATTGTGCATTGTAGCAGATCAAACGTCGATCTGCCACGAGATA
AAATACGTCACCAACCTCCTGGCAGTTGTAAACTGTCAGTATAGTCTTGGAAACGGACGGGTACAGGAAGAGAGCTATCCAGCAGTAGAGCTTCAGACAC
TTGTTTCGATACGTCAGATAATTCATGCGTAGCTTCACGCGAGCTTGCCAGACGCGAAGATTACTACGAATTGTACGATCAAGCATCGCACCGGAGAGTT
TATGTCGTTTTGTAGGACATTTGGCATGCACTGACCGAAACAAACCCAAATACGGGGTTCGGACTTGCGACATACCGAATTTACGCTTCAGGGCTCGAGT
CTCTTTGAGAGTTGAGAGAGCAGCCGTGCCTTCATTCTCTGGACCACCCTTTGCAGCTTCCACTGGACTAGATGAGCCAGACCGCTTATAGAAATTATAC
GTCCGCCACCAACTGCGTAGCAATCGAAGAGGATTGAAACTCTCGTCGTCGTTTTGAATCACTTCACTTTCCAGAACCGGAAGCCCGCAGCGCAGACAGT
TACGAGGAATTAGCTGCAGTTTGGAGCGATAACTGCGCATTCCGGCGTAGAAGTACGCGGTGATGACAGTAAGGGCGAGTACAACCAGGATCACGGTCAC
CCTGACGTAAAACAAAAATAACAAGTCAGACTACGATGAACACATGACAAACGGGTTGCAACTCACGTGAATTCAAAGTAGAAATTTTTCGTAACCACAC
AGTCGATTCCAGCGATGGCCACCAAATCCTACTCATAAAACACGTGCGTGTTATTCGGTAAATGAGAAATCAGCAAGAGGCTTGCGAGCTTCATACCAGA
TTGAACTTTTGAGAAATGTTCATAACATCTTGAACATTTGATGACCACTTGACGACGAAAGAGCTTTGGAAGTTGCCAAATATCTGGAAGAACCCAATGA
AAATCTTGAACTTGCTGGGGTTTACTGGGAACGTCCTCGGTGGAGGACTAACATCCACCCCAAATACCATTTTCACATTTCGACTCTGATATGTCTTGAA
AAATGCAGTGATCTTGTTCTTCACTTGATCCACTCGCCCCACCACTGCCATAGATTGTCGCCGATACTTTGCACCCGCACGTAACGCGATATGGCCACCC
TTCTTGGAATCAGGGGCTTTGAGTCTTCTATCAGCTTCAGCTTTCGCCAGCAGACCAATTTCTGTGAGATCACGTAGATAAAATCTAACACTGAACACTC
CTCCGATAAGTGCAAGAACCAGCAGCACAGGTATAACGAAGTTCTGCCATTTAATTGAGGCTCGAACCTCAGCGTTTGCCTCATTGCAAGCTACACAGCA
CAATCAAAAACCATTAAACGAGGGGCATCATGCTGATAACTTGAGAGCTGAGATACTTACGCAAACAAGAATTATCCCTGGCCCGCTTGTATCCATCGGC
ACACACGGAACAAATAGCCAAGTCGTACCCGCTGGTACAGGACACAGTACTCACTGCTGCTGCATGTGCGAGCATTTGAACCGTAACATCGGCTTGGCAC
GCGCCTTCAACCTATACACGCATTAGCCAAGTACAAATGTCAAAACCTAGCTCCAGCTTCAATAAGTTTCCAAACGTACGTCGCAGGTGTAGAAAGATTT
CCCAGATAAGCAGGAGAACAGACGATCTGCCGACCAGTATACGTTGAAATCGTTGAGATTGGAGCACTCATAGATCATATCTGAGAGGTTCTTCGTTGGG
TTCTCCAACGCAAGGTTCTTGCATGGATCTTCGTCCTTCCACAGGGATGGTTTATTGCAGCTAGATTCTTGCTTTGTTGCTGGGGCTGAAAAAAGATAAT
ACCCTTCCTCTGTCCGTGGGGATACCGTACCGAGTTCTTCGGCAATCGTGTCCGTCCCACGGCGTACGTTCATATTACACTTGGCGCCGGAAGGACAGTC
GAAGCACTTTAAACCATCCAAACTGCAGTAACAAATACGAAAGTTAGTATCAAATAGTCGAGTGCAATATCCACTGAAAACTAAGATAATACCTGTACAT
ATTTTTTGGACAGCGTTCACATACACTGTAAACATAACCAACGAATAAATATCAGTGCCACATTCGTTACCAGTCTCCTCGAATATCTGCAGATTACCCT
TGATTGACTGAATATCCTGGCTGACACGGCAGAAGCTTCACGCTCTGGACGAAAAATCTCCTTTCAGATCTTGGCAGTGTACACGAGATATCGGTCGTAT
AGATTCCTTCTTCGGGAGTTCGGTTGGCTGCTGTAAAACTGGCCCCACGATAGGAAATGACGCCACCGGCAGACCGGATTAAAGCCCGCGGCTCAAACAA
CAATCGCTCCGTTTGCTCACTACACAAACCGTCACTCACCATGCATTCTGTCTGATTGTCGAGCACTTCAACCTGCCCATAAAGATCCACGGCCTTAAGT
CGAGGCCATACATGCATTTTCCTCTCTAGGCTTTCGTTCCGTGTTTTGATGGCCTGAATTGATTCCTCATCAGGAGGCTCCAGTATAGGCACGCCACTAG
TCATATTTTCAGGCCACCACATCACTTGGACATCACGTGTATTTGTCGCAATATCGTACACTTCGTTAAATTCCATCGTGCAGGACGTACACGGGTACGT
AGGAGTAAGATCTTCATCCTCTGATACCCAAAAGATACATCCTCCGCTAGGTGCAGTGTTTTCTTTGCATGTGATTCTTGTAATCGTGGCATTATCAATC
GATTGGTAATATATCGCGCCACCACGAGTGAACGCAGAGTTCCTGATAAACTTGGCGTCTGATACACTGGTCGAGGAATGATCATCGGAATAAAGGGCGC
CTCCAAACACAGCGATATTGCCAGCTAATTCCCCCGCTTTCATGGTAACTTTAGCTTGGTCAGTAATAAAGAGAGCTCCACCAACTTCACTGGCTCGGTT
ACTGCGGAAATCGACCGATGTTAAAATAAAAGTGGATGTGCCAGATACTGCCATTGCTCCACCAAAATGTGCCACGTTATTTTCAAATAAAGTTTGCAAC
GCAATCGTGACTTTCGCCTTCACGCTTGTTGCAATCGCCCCTCCGTTTTGATCTGCAGTATTCCCTTCGAACACGGAGCTCATGATCGCTGCTGAGCCTC
CGCGATCAAAGTGAATTGCCCCACCAACTAACGCAGTGTTGTTTATGAAAGTACAGCTTGTGAGCTTTACAATGCCATCAACACAAGAAATCGCCCCACC
ACCTTCATTTTTACCGCTTGTAGTCACGCCTCCATTTCCAATGAACTGAGATTTATACCCAGCCAAAATCGCCTCTCGTCCAACAAAAACACCTGGGGAT
AAATAATCATAACAAACAGTTAATAGTCAACATATTTTTAAGAGAGGTAAGAAATTTCTTACCACATCCTTCTCCATGAGCGAAGTTGCGTTCTATGAAG
GATCCATTCAGAGTGACAGCATTTTTGTCTCCTGTGTCGATGAAGATTCCCCCTCCCGAGTCATCCGCAAAGTTGTCAGATATATTGGAGTTTTCAGCGT
AAAGCTTCGATGATGACTCCACATAGATCCCACCACCAGACGTTTTAGAATCTGGAAAAAAAAAGCGTTAAATAAAATCACACACCAATTATTTCATACA
AACTTACCGCTGAGTATCACTTTAACAGAGGTGAAATAGGCTTGGGCGCTGTTCGATAGACATACGCTACCTCCACGTTCGTTTGCCGTGTTGGAGCTGA
TTTCGGAGTCTTGACTATAGAAAAAAGCATTTGCGTTGATGTAAATTCCTCCTCCAGCGGCTGCCAATCCTTGCGTTGCGAATGATGAGAGCAGCTCTAA
AACAGAGTCTCTATCTGAGAGATAGACAAGGTCTCCTTTTTGAACTTCGACCTTGTTCTGTGCACGGCCTTCAACATGCTCGAAGCCGACAAGTTTGCTG
AACAAGTGTGGCCACGTACCTGTGAAAAATCTACCTGTATCGCGAGTGATATTGGCGTCAAGTAGACTGATCTCGGACGATTTAACTCCAGCAATGGAAC
CTCCGACCGGTGCGTCATTTGACAAGAAGAGCCACGTGTCTGCCATGACACTAGAGGGTCTATCGGGGTTAACTCGTTTATCTGAAAAAAGTCCGCCACC
TATACCGGACTCACTGTTACCGGCATGGTTCTCCATCACCAGTAAAACTGAGCTGTACAAGTAGACTCCATACAGAGAAATAGCCCCGCCACTAGTTTTT
GCAGAGTTGTTGTAAAATACGCAGCTCATGAGGTCCACTTCTGGCAAAAATGCCGAGCTTTCTGCCCATAATCCACCACCACTGTCGGTTGCAATATTTC
CAATAAAGCCCACATTTTCCAGAACCGTCTTTTCCGCATCGCTAACAGCAATCCCACCACCTTTAATCGCCGAGTTGTTAGCAACAAGAGAGTTTGAGAT
CACAGCGTTGCCACGACCCAAAACAAATACACCAGCTCCTTGCCCGAATTGTAAATTGGCACCAGAAATTACACACCCTGACAGAGTACAATTGCTTGTA
CAATTCATCACAACATTTGCCCCGTTGCCGCCTATCGGTTCGATAATATTCGCATCAATACGTGATCGTTGAGTGGCGCCATCATCCCAAGATAAAAGAC
TTGCTGAGTATAGCACGCTATTCAGGTATACGCCACCGGCTGTTGGAGCGACGTTATTGGAGATATCAACATTTGAGTGATACAGAGTGGCCTCAAAAAT
CATTACCCCACCACCCGATTCTCTAGCTTGATTATTCATTACCCAGGAGTCCCGAATCACGCAACTTGTACCCGATCCAAATAATAAACCGCCCCCCGAA
GTCGATGCTGACGAGTAGGAAATATCCGCGTTCAACACGACACATGACGTCGCATCCTGAGCTGCTAAACCACCCCCAAATGGTGCATGACTCTCAGTAA
TCACCAAGTCGCTGACGGTCGTTTCTTCTCCATCAACGAAAACACTCCCTCCGTATTCAACTGCTCGATTTTTAGTCAAGGACGCTGCATTCAGACTCGT
ACCAGTACTCTCCTCAGTCGGGTATTGGTAGAATGATGATGAATTGACATAAATTCCTCCGCCACGAATTGATGCACAGCTCTCAATTTTCAATGCGTAG
TGCTTGACATCAGCATCCACAATCGAAATACCCCCACCGACACCTTGTGGAACCGAACACGACTGGATAATTGTAGACCTTAATGAAAAAAGACCAGTTT
CAACAGACACCCCACCCCCCCTTTGCGATGCTGTATTCGCAGAGATGGTAGCTCCTTCCAATAACGAGATACCGGATGTAGCAACTCCACCGCCCCGTTC
TCCATTATTCTGGTCCACTGTAATGATACCCGAAAGACTTGAATCGATAGCATAGACTCCGCCACCAACCACAGCACGGTTGCTGCTGACTGTCACAGGT
TCTACCTGGATTGTAGAGTTTTGAGCATGCAGCCCACCACCGCTTGTAGTTGCCTTATTATTGACAACTTGAACCGATTTCATCGTCGCTGACGAAGCTT
CTTGTGCAACCACTCCACCTCCAATAGATGCTGAGCAATTTTGAACATCGAAGAACTCAATTGAGCTATGGAACCCAGTAATATACACACCACCTGCCGC
AGAATCTGCATGGCTATCGCGAACAACTGATGATACATCACTACCTCCAATGACTGAGCTTGAGCCGATGTACATCCCAGCACCATTTGTAGCGGTACAT
TCGGCAATCGAAGCTTGCAGTAGCAACACTTTACTTCCAGCATCAACATATACTCCACCGCCTAAAGCTGCATCACATTTTTCGAAGGAAGGATTTGTTA
CAGTTGCCGAACTGCAAGAAAACGCCGCACAACCCCCCGATGTTGTAGCTGACGAAGAAACCACACGAAGGTTTCGCACCGTTGGACGAGACCAATCACC
AGTGTAAAATCCTCCTCCACTAGCTAATCACAAAGGAAAATAAAAATATTACTCATCAAACAGAGATACGATAACTTCATCTACTTACCTGCTGTACAGT
TGGAAATCTCCGATGCCAACGTATTCTCAAATGAGCCGTTGGAAAGGATATACACTCCCCCGCCATTGCGATCGGCATGGTTCGTTTGTATCGTCGAGTT
CTGAAGCACCAGATTTGCCGAGTTTAGCATCGCAATTCCCCCGCCATGGTTGGTAGCACGATTGCCAATGACTTTCATGCCCGAAAGTGTTGAGCTTCCA
CTTGTAGCTGTTAATCCAGCTCCGACCAATGCTGTATTCTCGAGAACGTTCAGCGTTGTACCCGTGAAGGATCCAGAGATGCAGAGTCCACCACCGTTAA
TAGAAGCGTGGTTTTGCCACAAGTTACTGTCCTTGTCACCACTAACCGAAACTGAATTCTGCGCGTATATACCACCACCTTCACTTGCTGAAGAAAGCGT
GATGATCGAGTCATCAAGAATTAGGTCCGAGTTATCCAAGAAAATAGCACCACCTTTAGCAGCAGAACACTTTGTGATCTCCACGTTAGTAAACGTCAGC
TGAGACTGATAAGCGTAAATGGCCCCTCCATTCTGGCGAGAGTTCGCATTCGTGATGACCATATTCTTCATCTCAACTGCTGTATCTGTGACTTTAATTG
CGCCACCATCGGTGCTTGCTAAAGTATTTTGTATTCTAAATCCTTCCAGTCTGTTCGGCGCAGCATCACTTATAATAATTAATCCACGGAGAATGTTCTT
GCAATCAACAATTGTCGGAATCGGGCCTCTCAGCCCTCGAATGAGAAGACTAGCGGTTGATACAGTAACTCCACAATTGTCAACACCAGTGTAGATACCA
GGATAAAGTAAAATAGTTTGTCCGGACGTCGCGAGTTCTAGAGCCCGACGGAGCGATTTGACAGCTTTTGGGTCTGTTCCACTTGTAGAAGTATCCATTA
GCTCGCCTGTTCCTTGAGTATCATCCCCATTCTCACTTACTACAATCACATCATTCTGCGAATGGAGGCAAACTGGATCACACGTCGTTGATGTACACGT
TGTTAGGTCTTCAGGGCAAATAACTGCATTGGTGCAGCTTTCTCCAATAAAACCGCTGAAGCACGAGCAGGTACCTTTTCGACAAGCTCCATTCAGTGAA
CAGAATCCAGTGGGTGACAGTGGACACGGAGCTGAAACAGATTCTACTGCATCCGATGCATCGACGGTCTCATAATGTAGAGCCATCCCTTCGTAAGCCA
CGCTATCATCCGATGTGAACGACAGTGCCACACTATCCAGACCAGGTCCAGTTGATACGACAAAGTCTCCTTTTCGATGGCATCCCCCCTTCCACAGCTG
CTTCGTCACGCCTCCTTTTGTCACACTAATAGTTAAGCTGTCGTGGTCACATTCAAGCCAAAACAGAGAGAACTAGCAAAAGTATAACACAACAATGTTA
ACTTTGCACCATCGCGTAAGGCATCCAAACAGAGAATGTTAACTTACACTGATCAAAACACCGGCTTGATTCTGCGGCGTGATTGTCCATGTCTCGCTAT
CCAAGTTTTTATAGTCGTGCCAGTGAATGTGACCTTTGTTACCCACGCAGTCGAAGCCACTTGATACTGGGGTCATGGCAGTAAATGTTGTGGTTTCACT
TAGAGCGCTGATAGAACCGTCAAATCTGATGACTTGGACTTGATAAATGTACGTTTTGCCCAACACAATTTCATCCTCGTACGTAATATCTTCTCCATTG
TCAACGTAGAATTCTCCATCACGGAAAAGACGATAGCTGACCGCATCATCTTCAGCCTCCCAAAAAACGTTAGCCACTTTGCGTGAATCTACAAAAAATT
AACAGTACAGCCAAAGTTACAAAAAAGTAGTATTCTCAGTGAAATATTGTTCTTACGGCAGCCAACTTGTGGCGGTGAAGGCTGATGGGCATAGAGCGGT
GTCCTGAAGAAGATAATCTTGCTCGCTTCTCCTGATTCTCCAGCACCAGTGACTGCTCTCTGTAACATACCGTAACATCAGTTAGCAAGCTGGATTAAAC
AAATATCTTGACAAATACGTACCACCGTGGCAGTGTATTCAGTCTGGGGTGTTAAATTCTCGATAGTTAGGATCTGTTCATCAACTGGGGTGATACCAGA
AAATGTAACGCTGGGGTTTGATATCTGTACGATATTCAATCGATAGGTGTCAACGTAGCCTCCTCCAAAGTCGATGCATGGATCCCAGTGAATAGTGACG
GAAGTATTCGACAGCTCGGCGACGTGAACATCTTGAGGAGCTAGTGGAAGTGAAGTCGGCTCAGTAGTGAACGTAACCTCTTCGCTAGGTGGTGACACAC
CGACAGTATTGTAAGCGAATATTGTCACTGTGTAGTCCGTAATTGAAAGTAGATCTCCAACCGTGCAAGTACGAATCATGCCCTCGCAGCTCCCAACTTC
CTCGCCCAGTCTTGCCATACTAAGATGGTAGGATGTTAAGGGGACTCCACCCGTGTCAACTGGATCTGTCCAAGATAGAGTAAGTGCACCACCAGTAGCT
AAGGTAATAGTTGGTGGATCAGGAGCACCTGGAACAGTAGCCACCGACGTCGCTGTGGCAATACCGTTAGTGGTGTCACTAACTCCGACATCATTTGATA
TTTGGATTGTGAATGAATAAGCGGTAGACGGGAGAAGTCCTCCAGCTTGTAAATAGATAAAACCTCCACCATCTGCAGCCACTTCCATCGTTGCCAAGCG
TCGAGTTCTTGAGACGGTAATCGGCATATTCTGTAGTCGACGTACTGCATCTACTGGGACTTTAAACCCGTTCTCGTACACAGTACACACCAAGTCGTCA
ATGTTAACACCTCCAGTATCATTTGGGACTTGTATTGCCAACGTAGCAGAACCCCCAGACGATTGAAGGACAACCGGATCGCCTGGCAGTGAGGGTGGCG
TAGGTAAAGTAGTTGAAAATCTTTTGACGCTAGCGTCGGATCCTATTCCCAAACTGTTTCCAGCAAACACCTTGAATTCGTACACACGATTTGCTAGTAG
TCCACCGAAGCTTATTTCAGGTAGAAGTGACTCTAATGCCAGTTCAGGATTCCCACTCGTATCCTGTGCGTGAATAGAGTAGTAAGTGATCGGGCTTCCA
CCGTCATCATCGGGGCTTTTCCACGAAAATTTTATCATACCACCCGACGCGTTTATCAGTGTCAAGTCGCCCGGAGGACCTGGCGCCGAGATGAGGGTTG
TTCGTAGTGGATAAATAGACGAGTTACTAGAGTATCCAACTTTGTTCATGCAAGAAGCCATGAACAAATATTCCGTTACTTTCTGCAGCTTTGTTTGCCA
ATAGCTGATGTCCTTGTCGTTGTATATCCGCGTCCAAATTGGGATCGACCTACTTAGACTCATGTATATCTGGTAAGTCAGATTCTGATCACTTCCCCTG
TCATTCGGAGGTTTTACTTCCACGTGAATCCCGCCACCGGTGGCACCTGTTGATCGTATCAGCTGAATTGGCATTGGCTTCGAGGCCACATCTGTCGAAT
ATATGACTTGCTTTGGAATATCTTCGTCATCCCCAGCACAAGCTGATGCGTCGTTCAGTGGGATATAGTAGAAGCTGTAATTGTTTTCGGGTACCAATCC
ACCAATCTCCACAGTAACTTTAAGTTCGAAGTCACCTTGCGATATGTAATGGTATAGCGTTCCTTCCACCTAAGGGTCAAAGAAATGTTAGTTTTGAGAA
TAAAAAACGTAATGTCATTTCAGCAAATACTATACCGTTTTGTTATTGATGTAAAACTCGTAACCGGTGATAGGGATTCCACCTGATCAAGCAAAAGTAT
TAATTTCAAAACGGTACAACGAATTTCTGCACGTACGTACCAGTATCATCTGGCCAGGAAATGCGTATATGAAGTGCACCACCTGTGGCATAGTCGAGAT
CGGGTTCTGGTGGCATTCCAGGTCGGGTAGGAGCCACTGTAGTATAGTTCGCCACATCGCTGTAGGGCCCACGCACAAAAACGTCGTATTCGTCACCATT
TTGCAGACTTGAGGCGGCTATAGCTCCAAAGTCGGTGCTTAATGACGCTGAATACGCGATGGTGTTGTTAGATTGGACTTGTGTTGTGTCAACCTCGAAC
AAATAACCCTGTCAAGCAATTCGTGCGATAGTTAGCCATAGTGTACTTAATAAAATAAATTGTAAAATAGATAAAAGCAGCACATACGCCAAAGTCGAAG
TACCCGCTCTTTACAATCTCAGTCGCCACATTGTCCGATAGAGTGATCCGAGAATCGGAGACAGAAATTCTACCCCAAGTAATTACGTTTGCAGAGTCTT
CAAGGTGTGATACCGCTACCATATCGTAGGTAGTATCCGCCCCCAAACGGAAAATCGTGATCTTCAAGCCATTCGCTACGTAGTAAGCTTGACGAAATCT
CTCCCGAAGACCTTGTTTGCGGTAGTAAATCATGTACGAAATATTTTCATGTCCACCTGCCAGTACGCTAAATTTTAGTTCGTGCGTACCTAAAATTATT
GTGAACGTACCTGTGTCGAGCGGGGGCAAGAGGTCCAACTTTATTGCTCCACCTGTCCGCGATGATTGTATAGCGGGGAGTCGAGGTGGTCCAGGACGTG
ATAGTGGTCCACTTTCAAACGAAAAGGGCTCAGACATTTCACCAACTCCGACAACATTAATGGCCTGTAGCACGAACAAACTGTCAGATATGAATACTCC
CACCGAGTACCAGTTGATATCTGTCAAACATGCCTGAGCACGTATGATGTATGCAGTATTGGGCTTGGTCACGCTAACTGGTATTATCGATGATAGATGT
CCAGTGCCATTATAAGCCATCTACACAAATAAAAGAATCAATATGATGGGGCCTTCGACACAGCAATAGTTTTTCATCATACCTTGAAATCACTGCCTTG
TTCCGCCAGATGTACCACGTATCCTGTTATAGACGCTCCCCCAGAGTCACTGGGAGGAGCAACCGCGACTGTGAGTAAGCCACCCGTGCGATTCAGTAAT
GCAATATGTTCAGGTGGTCCTGGTGCTGTTAATTTTGTCGTAGAAAAGGTGACACTTGAACTGTCGACTCCACGTCCAATGCTGTTGATAGCTGAAATGC
TGAAGTTGTATTCCGTAAGCACATTTAACCCTCCGAACGGTATTACCGTAGCATTAGTAGGCGTAATTATCCAAGTTGTACCTTTGACAGTACGAATAGA
AACGTTGTATCCAGTAATCCAGACGTTTTGTCCGCCAACATTCACTGGAGGTTCCCACTTCAATCTCAACATCCCTCCTGTCGCTTTGTCAAGTGTTGGA
GCTTTCATCGCTCCTGGCATAGAACGATCACCGTCATCCTGTACCACCACTTTAATCACGTTATTTGTCCCTATTCTGGCCGCGCCTGCTGCAATTTCTA
GCGTAAGGTAGAAGCACAAGTACGGGAAATCATATACGTCGTTGTCTTTGATCACAATACTCGCAGATGAAGACGTCTGACCATCAACGAAGTCCACAGT
TGTGGATGGTAATCGAAACCCAATGTCAGGTTGAGTTGTGCTGGTCAGACCAGTATACACAAGTATTTGGACGCTCACTGCTGTACTCTTTCCGTATTCT
CGCTGCAATGGTAGACTTACAATTCGAGCATTCTCCAAGACGGTCACCTCAGTCACTACAAAGCTGATCATTCCGGCATCCCCGTCGTCCACAATTATGA
CTATTATAGGTGTAGGCGGGAATGGGTCGGAGCGATCCGGGGTTGTGTCAGTGAGTGTTAAACCTATTGTCCGCGGGATCGGCTCATAGATATCATTATT
GATGATTTGAACGTCAAAGCTCTTTTCTATGAGCTCCCCAACAAACGTGAAAGAGTGTTCAGAATCTGGTGGTAAACTATAGTCTCGACCATAGATAGCA
GTGCCTGAAGTATTGGAATACTTGCAAGTAATTGTACTTGAAGACCCGTTTACACGAAGCAATTGTACAGTCACACTCGTAACATTTTCAAACACAGTCG
ATGATGCCAGTTTGTACGTGATAACACCGCGTTGTGTAACATCTGTTTGAGCTGGTAGATCTGATGTCCAATCACTCGTTCCCGCCGAGTTTCGAGCCCG
AACTCGAAACAAATAGTCATTCCCTGGAATTAGTTTTGAGACCTCGACTGCTGTAGTGTTCGTCTCCACTTGACCGGGTTCCGACGTGTTTAAATTATTA
AAAGCGATCTCATAGACGACATCGTCGCCTCCCTTATCATCTGATTTGTCCCACTCAAAGAATACTGAAAATGCCGTTCGCAGCACCACCCGAAGATTAT
T