Description :
From Genome Similarity Track
Location :
Scaffold_1164:1990- 8861
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1164-snap-gene-0.43'5'-cyclic nucleotide phosphodiesterase
Pytul_var.sporangiiferummaker-pug3_contig_1164-snap-gene-0.5Fat-free family protein
Pytul_var.sporangiiferummaker-pug3_contig_1164-snap-gene-0.6Fat-free family protein
Pytul_var.sporangiiferummaker-pug3_contig_1164-snap-gene-0.7Cytochrome c peroxidase, mitochondrial

Sequence
6871 bases(100 bases per row)
TCAGTCGCTGAATTTGTGAGCATTATCGTTGATGAGGGCAAGAAGCTTATGAACTGCGATCGCTTTGGGTTTCTTTTGGTCGATCAACTCAAGAAAGAGC
TTTGGATCACGCAAATAGACGGCCAAAACGTCCGCATGCCAATGAACAAAGGAATATCGGGGCTCGTTGCAACAACAGGAGAGACTGTGTGCACTCGAGA
CGCATACACTCACGAGCTCTTTGACCCAAGTCTGGACTCGAAGACCGGCTACAGAACGACCAGTGTGTTATGCATGCCCGTTCTTGAGGACCACACACCA
GTTAACCCGAAGATTGTTGCAGTCGCGATGTGCATCAACAAGAAAGATGGAGCACGAGTTGTGCCGTTCACCAGCACCGATACGACCACAATGTCGCGAT
ATTGCCGGGAGATCCAATTTGCGCTTGGACGACTATCGCTTGACATTTCTTACTACAAGGTAGTTTCGGATTGTGGATTGAACGGCCCTCGGAACGAGTC
CCCCACTGAGCCAGTCATCAAAGCCACCGGATCTGTCATCACTCCAGATTCCCCGAAAGTGACGGAAACTGAAATCATCTCATCGATCGTGCATAAGTTC
TGCCAACTGAATGAACTTGAAGGAGTAGATGTGGTGGTATCCACTCCGTCATCCAGCCCTAGAGCTGATGCGTGGATTCAATCCGTGCATCAAAGCGATG
AGCTGGTCATGCTTCGTGAGAATGGGAACGTGATCGGTATCGGTGATCTCGACAGATGGGACTTCAACTGTCTCGATCTCTCTAACGCAGATATCTTCAT
GTCCGTGACAGTGATCTTTCGCGTATTTGGTTTTTTGGAAATGTTTCGTATCCACAGCGACAAATTTGCAACCTTCCTCTCCCATGTATCAAGTCACTAC
CGTCCGAATCCGTTTCACAATTTTCAGCATGCATTCCAGGTCATGCACGCAACCTATATCATGATCCGACGCGAGTGCAGCTCGTATTATTCGTCCGTGG
ATATCTTCACGATGCTTGTCGCTGCTCTTTGTCACGGTACGACTTCGAAAGCGCAAAAAAACAATGGATGCTAGTTAATCTGAACTCACTTTTCTGGGTT
TGCTCAACTGCACAGACATCGACCATCCAGGCAACAACAACGATTTCGAAGTCAAGTCTGTAAGCCAAATGGCGCTCACACACAACGACGATGCCGTACT
CGAGAGACATCACTGCCGCGTGACGTTTATTATCCTCAGCCACCAATCTGCCAATATTCTTGAGAACTTCCCGAAGGAGAGCTTCTTGAAAGTCCGACGC
CTGATCATCCACTGCATCTTGGCCACGGACATGTCGAAGCATTTTGACAAGTGCAAGTCCATTGAGAGTCTATCAAAGCGGCACTTGGGCGAAAAAAAGT
ATGTGCTCATGGCGCTCATACTCCACGCAGCAGATCTTTCAGGCCAAGCGCTTCCGTATGAGCAGGCTGTACGTTGGGGAATGCGCGTACTGACCGAGTT
CCAAAACCAAGCAAAAAGCGAAGCCGAGATAAAAGTCCCAGTGGACTCGTACATGACCAATTTGCATCAGATGAAAACACGGATCACCGTTCAGATGAAT
TTTATCAACTATGTGCTGCGCCCGATTTGGTTACCGCTCGCCACTGTGTGCAAGCAACTGCGCGTGTACGCGGACTCGCTGGAGTCCAACTTTGAGAGCT
ACAAGGCGGATCTCGATAAAATCCTCGGAGAACAGCATGAGAGACCACCAGTCAATTATGTCCGTGGTGAAAGTTCGCGTATGCTAACCAAGAAAGAAAG
TGCCAACGCGACATAGTCAACGTAAGACCGCTACCATCTACCTTGGGGTGATGTTACTTTTTTGTTAATGTATCGTTGATGCTCGAGTCTTACGCTTTTC
GGGACAGTACTTGGGTGCTTTTCGTGCTCACAATCGCTACCACATTGCTTTGTTCCATCAAGCTGTCTTCAAACGCTCGTTCGCGTGCATTCGACAGCAA
ATCGGAGAGCAAGCTTTCGAGTTCTTGACTCTCAGCGACCAAATGCACGGTCGTGCTTCGCAAAAACTCGGCATTCACTTGAATTTGCTGCAGTCCGAAT
TTACTGAATTCCTGAGCGCGCACCAGCTCGCCAAACGCCTTGATGCTCATCTTCAGCATACCTTGCACGAACCACTCCGTCGTCGGGTCCGCTACGGGCT
GGAAGATCTGAATTCGCTTCGCGAAAATGCGCTCAATGTCCAGTTGCATCCCTGACCCGCCGNNNNNNNNNNNNNNNNNNNNCGCGCGATTTCAAGCCGC
TAGTTCGTCGTCGGAAGTCGCGGCTCCCCGTGCGAGAGGAACTGAAGCCGCCGAAAAAGCCACTTTGCTCATCGCCCAACGCCAGCGCGATTTCTTTCCC
GAAACGGAAAGTGGCTTCCACAACTGCAGCAACCATTTCCTGCACGTTGCGAGGCTCGTCGTCCATGTCGGCCCATGAAGTCGCCTCCATGCCCTTTTGA
ATCGTCCCACACAACTGATTGCCGTAATGTTTCACGACATGCTGAACCAATTCCGTACAGGTCTCGCTTGTGACTTGCATCATATGCGCCACATCAAGCT
GCTTCCCACTGCGTGATTCTCCATCATGAGTAGCAGCGACAGATGGACTCTGCACGGAGTTCGACGGCAAGCATTCAACCAGCACTTGCAGACATTCACC
AATCCCTGCCGATGCTAACTCTTGGCACAAAAAGGCAAGGAACAGGAGAAACGGCGGTGTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCG
CGACCTCTTCATCTACAAACCTTTCCTGGCTGTTGGAACCGACATCATGAGGAGAAGACACGAAGGCTCGTTTCGGTTCCGTGTACGTTACGATGGAAAC
ATTGAACCACTTCAGGAAATGGTAAAATTGAGTCTACTCACATGCAACAGGCGATCAGTCGAGCGATAAAGTATGAACGAAAATAAGCGGACAACATACC
TGGACCAGATCCGAAAAGACCCGACTCATTTCACGCAAGATACTCGCCCCCGTTTGCACCAATGGCTCCATTTGTCGAAGCACGTGCTGCATCATCTCCG
TGAATCCTCGCGCGGCTTCTTGGGCAGCAGGCTGGACACTCTGACTCGTTCCACTGCTGCTATTACTGCTATTACTTCCTTGGCTGGTGTTGCGGCTGCT
CTGTCGGAGGTGGTTTACTTGGTAGTGGGCATTCGTCAGGAGCTCAACTGTGCCCACGCGAAGCTTACGGAAAACACGCTCGATCTGGAAACGCACACAG
GTCTCCACGATCTCAATTGCTCCGCCAACGAGCCGGCATGGCGGAATAATCGCATCAATCTCTTTCACATTCGACACAAAATGCTTCAGCACGCACATGA
GCACAACGTATTCGTCGTCTGAGACGCCACCACTGTGCTGCGTGAATGAATCCGTGTCGCGGCCTTCGCTCTGAAGACCATGGATCTCGTCCTCCGTACC
CTAGAAAACAAACGTCGATGAAGAATCCGTTGTAAGCGACGACTGCTAGGACCAACCTAGTCACAACAAAAAGACACTCACGAATTCTTGGTGTGGGCGG
CGGAATTGGCTCGCGCAGACACGCAGATAGAGCGCAAACAGTTCCCGCGCAAACGTGATAAAAGCATCGTCCTGCAGCGCTGTGGACGAGCGCAATCCGC
CTCGTTTCTCGCGCGCCACCAAATCGGGAAGAAAGTTGTCTTTATAGACGCGGAACACAGTCGCCATCTTCGTCAACACCTTGGCATTCACGCGCTGCAG
GAACACGAGCACGGACTCGTCCTCGTTGATCGTCTGATATGCGCCAATAGGTTAGCAGCGACGAGTTTAGTTCAAATATCAGTAGGAAGCGAAGAGTGCA
ATGACTATCGATTTCTCTTACCGTGTACGCTGCGAGCTGTGTTTCAAAATACGTTTGGTGCCAATCGAGAAATTGCTGCCGCATGTCGTCGCTGCATGCG
TCCAGTTGAGCGAGAAGCGACACAGTCTCGCAAATCTGCAAACCCAGAGTGGACCCAAACAAACGCAATCTTTAAGTACCACGATCTGTGTAAAGAGCAA
AGTGTCGACTCACTAGCATCAACTCTAAACCGAGTACGTACTTCTTCCGATGTGAGCGTCGTGTTACGCAGTCGCTGTGAGAGTCGTTGCTCGAGCTGCT
GCATAATCCTCTCGGCTTCCAATTGGATCGTCTGCGTATATGTTGATTGCCAACATGTGAGCTGCTTCAACAAATACACTCCAAAATCACGCTCATGGCA
CTTTTTAGAGTCGAGCTTACCTTGAAGGACGCAATGTGCTCGTACCGACCCAAGATGCGACGCGCCAGCAAATAGTACTTGGTCGCATTCGCGTACTCTT
CTTGCTTCAACGCTCTGTGTCGTACGACAATTTCTCCACGTTACATGCATGAAAAGAATTAGCTCGTTCAGTAAAGAAAACTCACGTATTTAAGCGCTGG
GGTAAGTCAAAGATGAACTCGAGTCGCTTCAGCAGGCGCCGAACGCCGATGAGCTTTTCCACCTTTGAGCGGTGCGGCGCCAACGCGACGTTGATGCTCT
CGCTCTTCTCCGTGATGACGTCCATGCTTTTCACGACTTTCACCACTTCTTCTTCCATGCTCGCAACGTTGTTCTGCATTCAGTTGATCATTACCACAAA
TTTGAAAAGCATAGAGTCACCGGCCGCGAGAGGTGAATAAAAAGGCTCCAAGCAATCGCGACATCTCAGTAGTGTAAAAAATAAAAAGCGCACATACTTT
CATCTTGCGAATCGTGTCAGTGGCGCTGATAAACTTGTTGTAGTTCTCGTACACGAGCATCTGCATGTTGGTGTCGAGCTCTTTGATCTCGCGAATCAGC
TGATCGTCGCGCTGCAGCAAATCGTTCAGACCACGCATTTGTAGCATTTCCTAGCGATTTTTGTTCACCACGTACACACACACATGTCATTAGGCATGAA
GAGAGAGATTGCGCCAAGCACAAACGCGAGCAGTCGGTGTACCTTGACGTAGGTCTTCGAGTCGAACCCCTTCGAGTCGATATTGCGCAGACTCTCGGCC
TCGCTCTCCTTGTCCTGCATACCGTAGTAGCTGCTCAGCAGCTCCTGCATGCGCGACATCCCGTGCTCTTCCGCCATCGTAGCCGCTCGTTCGTTCACGT
GGTGTTCGCCCCTCTGCTCACTAACCGTGCTTCGGTCGATCCTGGGAACCCAAATGAGAAGGAAGACTCTCTAATGTTGACACTCACTAACGCGTGTCTT
ATATGGAGGTAGCTTCACCTTGAGGTTTATTATTTTAGGGAAATGTCAGTGTAACCACCAGCTATAAATTATAATCTATGATAGTATAGATTGTTTAGTC
AAACACTTTTCAATTTATATTGAAGATCCGAAAGGGACCACCAGATTAGGCGATCCCATTCAGGTGATTCGCCCCCTCCCCCCTTCTTTCTTCTACTTGC
GATTGGATGCCAATATGAAAATCTGAAAGAGACCACTTCATCCACTCTTGAAAGCAGCATAAGTGGATGAGGCTGCCTAACGTCCCGAGCTCTCGTGCAC
AAAGCAAATTGTAATATGGGCACGTCGTCGCCCTGACAGGATGGCTACAGTCGGCGATTCCCCAGCCATCTTTCACGATGGGTGCGTGCCAAAGTGTAAC
TGCACTATGATGGCGCTGTTTACACAAAAAACTGCATTTGTGTCATGCTCTTGACCAGCCGCGACCACTTAATTTGATCCAGAACGAGAAAATTCGTTTT
TCGAAATAATGCGGCAATGTTCGTACTATTGTCACACCACTGTCATGAGGAAAAAACGAAAACTGTATTTTACGTATCAAGTCGGTCGCGAGTGCTCCTT
TGGTTCGCTTGCTATCTGTAAATATCAACACACCCTTGCGATGCGGGCGGGCACGAGATATTCAACCTAGTCGCTGCGTGGGCCAAAGAAGATGTACTTG
CGCCAGCCGGTCTTCTCCGGAAACTTGACGCCGTTTTCCGTGAGCTTCTGGAACGCCGCCGAGAAATCCTTGAACCACAACTCCTCGTCCTTGGCGTACA
GCTCAACGTACTTCTTGAACTCAGGGTCTTCGACCACGACCATATCCGCCGGGAGCATCATCAACTCACCTGTTGGGTCTTCGTACTGCATTGGACCGTT
CCATTTCTTCACAGTCCACTTGGTTTCCAGGAGCAGACGGAAGAACTCGTTCGAGAACGTCCACTCGGCGTTGGTCCATGGACCGCTGTAGCCACTGCGG
TCTNNNNNNNNNNNNNNNNNNNNNNNGGTAGCAACGGCCGATCGCGTGGGCACCGAGCAGCGCCACGATCTCACGGTCGTTGAAGCCCATTCTGTAGAAC
ACGTCACGCACGTGGTTCGAGTTCTTGGCCTTCGAGCCCTTGTCGGCGTCTGGGAGACGACCATCTGGAGTGCACTCCTCACCGCTCGTCGCATCCGGAC
GTCCGAGACGGAATGGTACTGAAGGACCACCCATTTCTTCAATCATGGTAACACCAGCGAGAATGTACAAGTCGGCGTACGTGATCTCTGGGTGGTTCTT
CTTAACCTTCTCAAGAGCCTTGACAGCCAAGTGGAGACCAGCGTTGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCCGACGAGTGCCACGCGAGACGCACCAACGTAGGGCCCATGTAGTTGTTCTCGTCAAAAATCTC
GATGATCTCCTTCTTGATTTGCTCCACATCTGGCTTCTTCTCACGCGCGTTGACCAGGTCCGTCATGGCGA