Description :
From Genome Similarity Track
Location :
Scaffold_1003:199- 2670
Transcript NameFunction/comments
Phyta_totarag11711hypothetical protein
Phyta_totarag11712hypothetical protein

Sequence
2471 bases(100 bases per row)
TGTAACGGGCTAAGACCGTTACCGACTTACATGAGCGCAGTGAGGAACTTGATAGTAGATTAGACTCTGAGCTTAACTGTCGAGACGGTATCGGCACTCG
AGACCGTCCCAACCACTAATCTACAACAGAATCTGGTTGGCCAACGTTCTGGGAAATGGTGACGTGGGACAGGCTGTGACAAGCCTGTCACACCACCCCC
TACTCAAGATAGGACACTGGTTTCTGAAAATATAGAAAGAGAGTACAACCCGGGTCCAGTGGGGCTTCGGACGTCAGTCGGAGCTTTGAAGCGGAGAGAT
GCGACAGCAGTGGCAACGTGGACGCGGGAAGAGTACCCACGCCGGACTCGCGCGGACGTAGCAGCTACTCGGAAGTCTTCGTGTGCTGGCCGCTTCATga
ctgcagcggcgtcgtggagCCCCTGAGCGACGATGAGATGCACGCCTGGTTCGAGCGCTGGCGTGGCACACGCGGCAAGACAGACGGTTACGAAAACTCG
CGCCGTGACCAAGCGCTCGCTCGATCAAGCGTGGAAGGCCTTCGTCGAGCGCTGGAACACGGAGTCGGCAGTGAAGTTCTGCCGCATCATCGAGACGCGC
GAGGCAACGCACGAGCGAATGTCGGCTGGCGTGCTCGCTGCGAAGGTCTGCAAAATGTCGTGGGACTCCGATCGCACGTGCTGTTACGTGCACTACCTGG
AAGGTTGTCAAGGCTGTCGCGGGTACGGACTCCCGCGACCGTACGAGACAGAATGGGCGCGCTTCATCAGCGACATTTCGCTTTCGGACTCCGAGGTGAC
GTGGATCGGCTGGTACCGCAGGGTCTTGTATGAAGCTAGGCGCGGCTCGCTGCCGCACCCGTTGGAAGACCGGTCTCGTACGCCGCCACGCAGTCCGGAA
CGTCCGCCATCAGGGACGTTCGAGGCTCTCAGCTGTCCTCCATCGGACCGAGCCACCGCACCAGATACTGACGATGCTCCGGTATACTACCGTCTCGGTG
TAGCCTACCGCGACCCGTACGCCGCCTAGTCGACGGGAGACCGCGAAGatcgtcgtgctgcacaATCGCCTCGGCGATATGGCGGACATTCCCAGCACTA
TCCACGAGTGGAGCTGGACCATCGCGCTGGAATTCAGTCTGTGAGCAGGCAGCGTCTTGACGACGTGTTGCGGCGGCTGGAGTTTCTCGAACAGGAGAAC
GTGGCGCTGCGtgaacagctgcagcgccagtcgACGACGTACGGGGCGCCGCCGCAGTGGCGTCGGTGGAGCATCGTCACTGGGGATAGTCGCGGGTCGG
TAGCGCCGGAGTCTGCTGACGTGGCAGGTAGGATGGAGACGTAGTGCAGTAGGTAGTTGCAGTGTGTAAGCATCTCCCACCACCTTCGTAATTTTGAATG
GCCCAATCTATCTGGGCGCGAGCTTGTTGGCGCCTACATTCGTCACCGAAGTAGGTTGAATGCCGGCCGTGGAAAGCAAAACACGGCAAACTTCTCCATA
TTCTTGCGCCCGCGCCTGTCCGCATTTTCCTTCTGGCGATCGACAGCACTCGCGATCGCGTCTCGCACGTAGCGCACCACGGACTGACGCTGATGAAGGA
ACTCGCTGCTGACCGCAGAGCCTTGCGGCGGCGGACGAGGACTGAAGTTCGCAAGAGGACGcactgggggggggggggctgcgTCCGGTTCGTCGTGATA
GGCGACTGcccgacgctgctggcgtgGGTTGATCAGCGTCCTCGACGTCCAAGTCGTGATGTCCCGTGGGGTCTCAGGTGACGCCCTCGTGGCGGCGCGC
GTGCGCACACCTCGCGTCGCAGGCTTAGACGCGGTTCGTGTCTGGGTACCGTTCAACGGGGTGGAGATCATGCCGTGAGCACTCTCATGGTCGCGCGGCG
CTGGCAGAGTCAGCATCATCGCCAGATTGGTCATCAGAATTGGTCATCCTCGGGGTCGTCGCGCCGGACGCGGGGTTGCCGGCGTCCTCATTTTCAATGT
CACTTGTCAGCGTCGAACGCTCCATTCCAAGGAGCGCCGGAGCTCGGGGATGTCGGCTGTAGTTCACGAAGAAGGGCGTGAGCCCCGTCGATGTGTGGAC
GTCGTTGTTGATTGCGAATTCCACCATGATAGGAACGAGCTCCACGATATGAATGACGTGGCGTAGCGGCGCAGCACGCCCTCGAAGACGTGATTCACTC
GTTCCGTCTGGCCGTCCGTCTCTAGGTGAGCTGCGGTAGACATCAGTAGCCGCGGGTCGAGAGTCTTGATGAGCTCCGACCAAAACGCAGCTGTGACGCG
GGGATCTCGATCGGACACGGTCGAGGTCAAAAGTCCATGATATCGGTACACAACATCGACGAAGATCGCCGCCGTCTGTGACACGGTGATGGAGGTCGCC
ACGGGGGTAAGatgcaccatcttgctgaatCTGTCGACGAAGGCCAAGACGCCCGTGCGATCGTGGGTGTC